In the beginning, the biological role of hexameric isoenzymes of NADH-glutamate dehydrogenase (GDH) was described in enzyme kinetics as the signal integration and discrimination function of the enzyme. But with the discovery of the RNA synthetic activity and the understanding of the properties and the chemical mechanisms of the new RNA (chimerenomic RNA: refer to the Appendix for the new terminologies) in aligning all the cellular and metabolic processes with the changes in the environmental conditions, it became abundantly imperative that chimerenomic RNA could not be described with the terminologies of genetics and genomics. The new RNAs (chimeres and NTintis) differentially degrade superfluous mRNAs, rRNAs, transfer RNAs etc homologous to them when there are physicochemical changes in the environment; the changes in the total RNA abundances are then followed by reprogramming of the physiological processes of growth, differentiation, respiration, cell death, drug catabolism, drought and pest resistance etc so that the cell, tissue, whole organism achieves equilibrium of survival within the available resources in its environment. The function of NADH-GDH hexameric redox cycle isoenzymes (GDH-chigramming) is to convert the diverse physicochemical changes of the environment to an electromagnetic molecular dataset, the nucleotide sequences of chimerenomic RNA enzyme. This capability is embedded in the subunit compositions and their 3-D conformations in the GDH hexameric isoenzymes. The energy involved in the conversion of the genetic information in total RNA (mRNA, rRNA, transfer RNA) to another electromagnetic dataset, the amino acid sequences of proteins is of comparable biological importance and significance as the conversion of the environment-wide physicochemical energy changes of cells, tissues, whole organism to another electromagnetic molecular dataset, the nucleotide sequences of chimerenomic RNAs. This review updates the recent advances in the differential control of the abundances of total RNA by environment-mediated changes in GDH molecular chemistry; and interjects some of the new terminologies therefrom for describing the new RNAs. It shows that the chemistry of GDH unleashes into a new domain order of the life sciences, new medicine, new pharmacology, new molecular biology etc for the improvement and consolidation of human disease management, treatment, primary care, welfare, and economics.
*Corresponding author (GOO) email: osujigodson99@gmail.com Formerly at Prairie View A&M University, Prairie View, Texas. ^ American Academy of Primary Care Research (AAPCR), San Antonio, Texas
1.0. Introduction.
NADH-Glutamate dehydrogenase chigramming: Many human health disorders are inexplicably entangled and concealed in human physiology, nutrition, genetics, pharmacology, neurosciences, genomics, metabolism etc [1]. Illumination of those persisting inexplicable biological phenomena will open new medical interventions for prevention and possibly also transformational therapies for treatment of more human health disorders. In this regard, the most notable nascent science is the synthesis of high molecular weight nongenetic code-based RNA (NTinti) by NADH-glutamate dehydrogenase (GDH; EC 1.4.1.2) hexameric isoenzymes. GDH is a complex enzyme both in its Schiff base dependent chemical mechanisms and in the 3-D conformations of its subunits in the hexameric isoenzymes [2]. Using crystallographic X-ray diffraction to study GDH allostery, Peterson and Smith [3] observed that the binding of NADH kept the GDH catalytic cleft in a closed confirmation, but binding of ADP behind the NAD+-specific binding domain kept the catalytic cleft open. Binding of glutamate to the NAD+-specific domain induced a large conformational change that closed the cleft between the two domains. Similarly, Bera et al. [4], using cryo-electron microscopy and molecular dynamic simulation to study GDH allostery reported that the binding of NADH triggered anticlockwise conformational rearrangements that enhanced the binding of the inhibitor GTP with the consequent inhibition of the deamination activity. Studies on the allostery showed that GDH from higher organisms is a dimer of trimers stacked on top of each other with the crystal lattice of the hexameric GDH isoenzymes having front and back conformations, demonstrating that allosteric regulation plays a crucial role during in vivo catalysis.
The protonated Schiff base intermediate between the enzyme and α-ketoglutarate (α-KG) is predisposed to nucleophilic attack by ammonium ion, ribo-nucleoside triphosphates [1;5], saccharides, amino acids, phosphate, K+, sulfate, polypeptides, chitosan, toxic substances (including but not limited to phytochemicals, heavy metal ions, psychotic chemical substances etc), tetrachloroiso-pthalonitrile (fungicide), naphthyl N-methylcarbamate (insecticide), methylethyl-1H-2,1,3-benzothiadiazin-4(3H)-one2,2-dioxide (herbicide) (GDH-chimmerization) in the cell [6]. In the active site of GDH hexamers, the protonated and the unprotonated Schiff bases of adjacent subunit polypeptides cooperate [7] to catalyze ribo-nucleoside triphosphate (ribo-NTP) polymerization reaction by orientating the 3’ nucleotide residue at the growing end of the RNA, and the incoming ribo-NTP, in juxtaposition to permit nucleotide bond formation to occur [8]. The aggregate GDH hexameric isoenzymes of any tissues have different pI (isoelectric point) values ranging from pI ~4 to 9.5. So, in any environmental conditions, only some of the isoenzymes will be at neutral pI value. Schiff base complex formation is more/less catalyzed by a physicochemical cooperation between the protonated and the unprotonated adjacent hexameric isoenzymes.
When there is a change in the environmental conditions, the nucleophiles that attack the Schiff base complex are not only ribo-NTP; they lead to the formation of dead-end complexes that inactivate the GDH. The inactivated GDH polypeptides are degraded by proteases. Thus, a new GDH isoenzyme population pattern arises in the cells, tissues, and the whole organism whenever there is a physicochemical change in the environmental conditions. The prevalent GDH isoenzymes then spontaneously synthesize a new set of chimerenomic RNA enzyme (NTinti), which immediately degrade and wipe-out pre-existing superfluous mRNA, transfer RNAs, rRNAs etc that the cells and tissues no longer need for metabolism and biological programs of survival; and they unleash a new biological order that is in equilibrium with the new environment, for the continued survival of the organism. The fundamental function of NADH-GDH is therefore to convert the physicochemical environmental changes into the high molecular weight NTinti RNA primary structure. The conversion of the environment-wide changes of cells, tissues, whole organism to the nucleotide sequences of chimerenomic RNAs is of similar biological importance and consequence as the conversion of the genetic information in total RNA (mRNAs, rRNAs, transfer RNAs) to give the amino acid sequences of proteins. Environmental conditions can now be analyzed and described as specific RNA databases (Chigramming) different from gene bank genomics. This is a novel translational understanding of GDH molecular chemistry that holds the potential for groundbreaking innovations with potential to transform several branches of the sciences, medicine, pharmacology, engineering, economics etc.
The inactivated dead-end complexes of GDH have been immunochemically demonstrated [6]. The identification of GDH dead-end complexes is live evidence that GDH is the enzyme that synthesizes chimerenomic RNAs (chimeres and NTintis), and that GDH-chimmerization and chigramming are studies in chemical reaction mechanisms [6]. This organic chemistry mechanism, being template independent, spontaneously synthesizes giga quantities of chimerenomic RNAs which then degrade homologous total RNA (mRNA, rRNA, transfer RNA) thereby leading to the reprogramming and repositioning of metabolic processes [2; 9].
The chemistry of NADH-GDH was described albeit hazily using genomic vocabulary in the past four decades, but the expanding knowledge about the complexities and the huge quantities of chimerenomic RNA synthesized by the human enzyme have catapulted to the development of new terminologies and glossary for specific description of the translational and transformational science, new medicine, innovative pharmacology etc appertaining to this new approach for solving some of the inexplicable phenomena in the life sciences. As an example, in the beginning, the biochemical signaling function of NADH-GDH was described in enzyme kinetics as signal integration and discrimination [6; 10]. But with the expanding understanding of the chemical properties of chimeres and NTintis, the function of NADH-GDH is to convert (chigramming) the physicochemical environmental changes and signals into the RNA primary structures of chimeres and NTintis for the spontaneous reprogramming of intermediary metabolic processes. Chimeres and NTintis are RNA enzymes. This conversion of the physicochemical environment into RNA primary structure is in parts embedded in the subunit compositions of the GDH hexameric redox cycle isoenzymes [11]. Transcription in molecular biology does not convert environmental physicochemical changes into the primary structures of genetic code-based RNA. Chigramming and functional chimerenomics constitute the innovative pathway that leads to this new science, new pharmacology, and new medicine [1]. This review begins to summarize the advances in, and potential therapeutic applications of GDH-chimmerization.
GDH synthesizes plus-RNA (chimerenomic RNAs) in the reductive amination direction, and minus-RNA in the deamination direction (chimerenomic RNAs) [1; 12]. This means that the redox cycle hexameric isoenzymes do not catalyze reversible reactions. The hexameric isoenzymes possess different isoelectric point (pI) values [13; 14]. The chimerenomic RNAs synthesized by the alkaline isoenzymes (β6) have high A+T contents, those synthesized by the acidic isoenzymes (a6, and α6) have high G+C contents [12]. Therefore, the GDH hexamers exercise chemical specificity, selectivity and preference [15] in their reaction with ribo-NTPs as substrates in the template-independent production of chimerenomic RNAs [11]. A comprehensive approach to GDH research program in terms of the cells and tissues of organisms utilized is imperative henceforth because the chimerenomic RNA enzymes have the activity to degrade the entire total RNA of the organism, a chemical avidity that is above and beyond those of siRNA [16], ribozymes, and ribonucleases [17].
Food crops (yam tuber, cocoyam, sweetpotato, cowpea, peanut, soybean, medicinal plants etc) have been preferentially chosen as the experimental organisms in the empirical stages of the chimerenomic RNA research program because they are the primary sources of nutrients, cholesterol-free dietary proteins, and several health beneficial phytochemicals throughout the world. Their NADH-GDH hexameric redox cycle isoenzyme fingerprint patterns on polyacrylamide slab gels are like those of homo sapiens [18]. But the crop harvest yields are suboptimal due to several unfavorable environmental practices employed for their cultivation. GDH chigramming is spontaneously induced by a wide range of environmental factors including soil organic carbon content, cellular intermediary metabolites, biotic/abiotic stress factors, mineral ions, drought, temperature extremes, agricultural chemicals etc. Therefore, food crops are suitable organisms for investigating the molecular chemistry of the chimerenomic RNAs (GDH-synthesized nongenetic code-based RNAs), and for expansion of the application outcomes to biotechnology, neuroscience, medicine, pharmacology, physiology etc.
2.0. Design of Experiments in Chimerenomics: Chimerenomics embody the methodologies for exploring the life sciences to understand hitherto inexplicable functions of the physicochemical environmental factors in their temporal and spatial control of metabolism that assure the survival of the organism. Excessive exposure to toxic substances is the major environmental factor that affects the survival of organisms. Since GDH-chimmerization is based on chemistry, it becomes mandatory that the experimental design of chimerenomic research must embody a comprehensive network of controls: from the maintenance of the organism, the application of the physicochemical environmental factors, GDH-chimerization, to the production and functional characterization of chimere and NTinti.
The correct scientific maintenance protocols for the experimental organism (whole organisms, tissues under culture etc) before and during the experiment is abundantly necessary for the success of chimerenomic project. The protocols (cell culture, animal care, horticulture, agronomy, fishrey etc) will vary according to the biology of the experimental organism.
Since nucleophilic substances react chemically with the GDH-Schiff base complex, the pure experimental chemicals must be applied to the organism in molar (M, mM, µM, picoM, fentoM) ratios. Application of the nucleophiles on weight basis did not work. Furthermore, because chimerenomics is rooted in the chemistry of the 28 hexameric isoenzymes of NADH-GDH, mixtures of subsets of structurally/functionally similar nucleophiles must be prepared to mimic the stoichiometric subunit polypeptide compositions of the NADH-GDH hexameric isoenzymes. Nucleophiles, mixed in stoichiometric ratios that mimic all the 28 hexameric isoenzymes of NADH-GDH constitute the core of the environment-wide experimental paradigm in chimerenomics research programs [19]. Mixtures of nucleophiles on gross weight basis that did not mimic any of the hexameric subunit composition of GDH did not work.
Chimerenomics is a scientific methodology in the life sciences that relies on the differential comparison of networks of experimental chimere and NTinti databases from hierarchical parallelograms of controls to deduce the molecular mechanisms in biology of the inexplicable actions of the environmental factors under investigation. To achieve this parallelogram of controls:
a). an environmental substance was applied in three dimensions to the experimental organism.
b). other environmental substances that are functionally related to but chemically different from the experimental substance were included as the 4th dimension in the research plan.
As the proof of concept, all extracts of NADH-GDH from the experimental organisms were upfront demonstrated through GDH-chimmerization protocol to contain redox cycle hexameric isoenzymes on native polyacrylamide electrophoretic slab gel. When there were technical errors in the chimmerization protocol, there was no chigramming.
In the first dimension, a subset of four or more environmental substances that were structurally and functionally related were selected.
In the second dimension, the environmental substances were applied at about fifteen increasing stoichiometric ratios (covering the range from normal to slightly toxic concentrations) to the organism because the physiological responses of organisms to environmental factors are nonlinear.
The third dimension involved specific provisions that take the unique idiosyncrasies of the biology of the experimental organism into consideration.
In the fourth dimension, two or three increasing stoichiometric ratios (covering the range from normal to slightly toxic concentrations) of the chemically unrelated environmental substances were applied to the organism.
These four dimensions are the basis of the special multiplicate parlance of chimerenomic research design. Multiple statistical repeats of all or some of the four dimensions of the project’s design was a waste of manpower and did not produce new knowledge.
In this innovative research thought, it must be emphasized that the biological controls without the environmental chemicals/substances neither represented the control GDH, nor the control Schiff-base complex, which manifested themselves during the differential chimerenomic data analyses of a comprehensively, and synchronously designed elaborate chimerenomic project. The trends in the stochiometric concentrations of the environmental substances are of the utmost importance in the differential functional chimerenomic data analysis.
GDH redox cycle isoenzyme population distribution pattern per untreated control and all the substance-treated experimental organism were analyzed, and the results photo-documented as the biochemical evidence for the involvement of GDH-chimerization in the processes. Also, technical errors in the handling of the experimental organism, purification of enzymes, chigramming etc led to negative experimental outcomes.
Preliminary and pilot investigations (test of concept) in chimerenomics need only involve two or three of the four dimensions of a regular elaborately planned chigramming episode because the overall objective of preliminary project is to cause an implosive and explosive tectonic-like quake at the very foundations of science, so that the chimerenomic shake-up of science will capture global attention. Therefore, preliminary/pilot chimerenomic investigations have so far adopted the first three dimensions of chimerenomic research protocols [6; 8; 10; 11].
3.0. Inexplicable Phenomena in Phyla dulcis Biochemistry: This section illustrates the GDH-synthesized (chimerenomic) RNA methodology as applied to decipher the inexplicable phenomena in the low biomass appearance of the P. dulcis plants, and their high contents of monoterpenes but low contents of sesquiterpenes in their terpenoid biosynthesis. The plants grow on marginal soils; irrigation does not improve their biomass feedstock yields. Phyla (Lippia) dulcis (Verbenaceae) is a Central American plant used by Aztac peoples as herbal sweetener [20]. Herbal ingredients in dietary supplements for control of diabetes and obesity are gaining popularity and have a huge market [21]. One of the predispositions to obesity is the intake of high caloric foods. So, more research was focused on the chemistry of zero-calorie sugar substitutes. There are over 100 medicinal plant-derived sweet compounds of 20 major structural types that have been reported and are isolated from more than 25 different families of green plants [20]. Phyla dulcis has two sesquiterpene sweeteners: hernandulcin and 4β-hydroxyhernandulcin which are 1000 times sweeter than sucrose [22]. As such, they have potential for use as natural low-calorie sweeteners in the dietary management of diabetes/obesity. However, other compounds in Phyla extracts are undesirable and include camphor, limonene, terpineol, α-pinene, α-copaene, trans-caryophyllene, δ-cadinene, and α-bisabolol [23]. Efforts to remove the camphor from the leaf extract through hydro-distillation [23], supercritical fluid extraction technology [24]; microbial degradation of the camphor [25]; hernandulcin production in yeast [26; 27]; and/or production of hernandulcin by hairy root/shoot culture of P. dulcis [28] had failed. Further complications in the P. dulcis biology include the variability in their chemical compositions of the monoterpenes, and sesquiterpenes which depend on the origin of plant materials cultivated, and the stage of maturity of the plant part selected for analysis. Various biochemical variants of Lippia alba also exist. But the molecular reprogramming that conferred the biochemical characteristics has defied genomic and genetic interpretation. Phyla species abound in terpene and sesquiterpene synthases [26; 29; 30]. Therefore, it is anticipated that some of the regulatory targets would be associated with the mRNAs encoding the monoterpene and sesquiterpene synthases. Earlier chimerenomic results had demonstrated the successes in the utilization of some environmental conditions (soil organic carbon contents, mineral salts, chitosan, and nucleotide solutions) to alter the yields of fatty acids, resveratrol, amino acids, cellulose, proteins, and biomass feedstock metabolic pathways of crops including sweetpotato, soybean, peanut, and cowpea [31; 32; 33]. The mechanism is that the nucleophiles (stoichiometric mineral ion, and nucleotide mixes) induced the GDH to isomerize (GDH-chimmerization) and to synthesize chimerenomic RNAs which degrade mRNAs homologous to them [34]. GDH is the target site of the action of nucleophiles including nucleotides, mineral ions, herbicides, pesticides, fungicides etc. Such life sciences-based systems research approaches had not been applied to Phyla species. With the perfection of the detailed analytical chemistry of terpenes [25; 26; 29], it is logical to focus research attention on potential technologies for production of high-hernandulcin P. dulcis biochemical variants. The phyla sweetener industry generates about $1.5 billion [21; 35]. Wherefore, the proof for the GDH chigramming research concept was the demonstration of the chimerenomic RNA synthetic activity [36] of P. dulcis GDH and characterization of the metabolic functions of the chimerenomic RNA as reviewed hereunder.
To assign functions to the cDNAs of the chimerenomic (GDH-synthesized) RNA, their sequences were used to search the GenBank databases with the BLASTN etc. algorithms. An overview of the mRNA targets homologous to the differential cDNAs of chimere (Tale 1) showed that overwhelmingly the mRNAs encoding the enzymes of primary metabolism were the targets of the chimerenomic RNAs synthesized by the acidic GDH isoenzymes; whereas predominantly the mRNAs encoding the enzymes of natural products metabolism were the targets of the chimerenomic RNAs synthesized by the neutral and basic GDH isoenzymes [37]. These are important molecular differences and similarities that would allow environmental conditions to be focused either on the primary or terpenoid metabolism of the plant species. The acidic GDH isoenzymes chigrammed the RNAs that shared sequence homologies with mRNAs encoding Phyla primary metabolic enzymes including dehydroquinate dehydratase/shikimate dehydrogenase, small subunit of ribulose-1,5-bisphophatase carboxylase, cytochrome P-450 reductase, granule-bound starch synthase, pyruvate kinase, glucose-6-phosphate dehydrogenase, protoporphyrinogen oxidase, phosphoenol pyruvate carboxylase, quinolinate phosphirobosyltransferase, photosystem II protein, and coumarate: coenzyme A ligase. The acidic isoenzymes also chigrammed the RNA that was homologous to the mRNA encoding peroxidase. All the above enzymes are involved in the processes of saccharide and photosynthetic metabolism. The mechanism of GDH-chigramming is that they degrade mRNAs homologous to them [5; 34]. This means that in the naturally growing P. dulcis plants, their photosynthetic and growth activities are severely down-regulated thus explaining the shriveled phenotypic appearances of the species. The downregulation of the mRNA encoding peroxidase means that the plants will be deficient in cell wall production and stiffening. The importance of chimerenomic RNAs is that in vivo they silence mRNAs homologous to them thereby reprogramming metabolism.
The alkaline isoenzymes of GDH chigrammed RNAs (Table 1) that shared sequence homologies with mRNAs encoding Phyla terpenoid metabolic enzymes including β-caryophyllene synthase, (+)-epi-α-bisabolol synthase, bicyclogermacrene synthase, α-copaene/δ-cadinene synthases, trans-α-bergamotene synthase, terpene synthase 1, bifunctional sesquiterpene synthase, geraniol synthase, and prenyltransferase. These are some of the terpene synthases that were known before [26; 30]; and the encoding mRNAs are related to the enzymes that synthesize some of the undesirable secondary metabolites of Phyla [23; 29]. The downregulation of all the mRNAs encoding the natural products metabolic processes means that the sweetener (hernandulcin) content will be low accordingly, there being no mechanism to decouple the monoterpene (camphor) synthase from the sesquiterpene (hernandulcin) synthase. This explains the hitherto inexplicable inability to genetically decrease camphor production while increasing the sweetener accumulation. Chimerenomic mechanisms operate above the board of genomic restrictions.
There were also structural similarities between the RNAs chigrammed by the acidic, neutral, and basic isoenzymes of P. dulcis GDH. The chimere #1 (Table 1) homologous to the mRNA encoding dihydroquinate dehydratase shared 3-fold matches two of which were plus/minus, and the remaining one had a plus/plus sequence matches with the chimere # 12 homologous to the mRNA encoding β-cryophyllene synthase, a natural products metabolic enzyme. The chimere #4 homologous to the mRNA encoding granule-bound starch synthase (primary metabolism) shared 5-fold plus/plus sequence matches with the chimere #17 homologous to the mRNA encoding bifunctional sesquiterpene synthase, a natural products metabolic enzyme. Thus, chimerenomic RNAs downregulated the photosynthetic metabolic processes and reprogrammed the terpenoid biosynthetic processes and vice versa so that the P. dulcis plants lived within the limits of the available resources in their environment. Structural similarities between a chimerenomic RNA and several mRNAs in different biochemical pathways constitute the channels of cross-talks that differentially regulate or reprogram metabolism [31; 32; 33; 34] through coordinate degradation as distinct from coordinate expression of transcripts. GDH is present in the cytoplasm, chloroplast, and mitochondria thereby enabling the chimerenomic RNA it synthesizes to reprogram different metabolic pathways.
4.0. Mechanism of Total RNA Degradation by Chimere. The chemical nature of GDH chimmerization leads to a discussion on the mechanism of silencing of total RNA by chimere. All the chimerenomic-based Northern probes (Table 1) recognized their target mRNAs or rRNA based on homologous sequence similarities.
_______________________________________________________________
Table 1: Functional Chimerenomics: Enzymes and mRNA accession numbers, and cDNA sequences of chimeres (GDH-synthesized RNAs homologous to the mRNAs) of Control Untreated Phyla dulcis plants.
______________________________________________________________
(1). 3-dehydroquinate dehydratase/shikimate dehydrogenase isoform ID:gblAY578144.11.
Chimere:gggtgcatagcggcgcgaattcgcccttactggtctcgtagactgcgtacccgataatcctcagcaaatgacaacgtggctg gccgggcaagcctcggaccccgtaaagcgcgcgtccttgttgacgcacttttccctcaaggatcaagctgacagaacgttttcagacggcg tacgtcagaccctgcaggggatgggaaactggtccgatgcgcaggcatcaggcaatgctttccttgcgagcctcaacggttgggtgccgg atcgtttcatcgctgttgagcagttgcacggtgatcctttcggtcaggactcat.
(2). Chloroplast ribulose 1,5-bisphosphate carboxylase/oxygenase small subunit ID:gbIKM025319.11.
(3). Cytochrome P-450 reductase ID: emblX96784.11.
Chimere:tgagcgtattgcggncgcgnnatcgcccttgatgagtcctgaccgatataacgcgaagaaccttaccaggccggtacgcag tctacgagaccagtagcgatgagtcctgaccgggtacgcagtctacgagaccagtagtacgcagtctacgagaccagtagtacgcagtcta cgagaccagttgtatgctgtttactggatgcttttgggcctggtagactgttccgtttagtgtaggtttgttgtgaacttggtgtggtgag.
(4). Granule-bound starch synthase ID: gbIEF584735.11.
Chimere:ccttactggtctcgtagactgcgtacccggtcaggactcatcagtcaggactactggtctcgtagactgcgtacccggtcagg actcatcgctatatcggtcaggactcatcaa.
(5). Pyruvate kinase (plastid isozyme) ID: emblZ28374.11.
Chimere:tatttttcttattcggcgccatactctctctctgtgctcacagaccgcgcaatactggtcgcgactcactactaatgggcccggaa agggtcttcgcgatatatcagtcacgactacatcaccttatagaccacgactcatcacatcagtcatgactcatcatatcagtaatgatcataat attggtcacgactcatcaagggagaattctattaaacctgcaggactaccctctttaatgatggttaattatgatcttgtagta.
(6). Cytosolic glucose-6-phosphate dehydrogenase ID:emblAJ001769.11.
Chimere:caggtgatagcggncgcgnattcgcccttgatgagtcctgaccgatatagcgatgagtcctgaccgatatagtgatgagtcct gaccgatatgcttttctccaggcgtaaaaaagcccgctcaattggcgggctgctattcttcggtcgggtacgcagtctacgagaccagta
(7). Protoporphyrinogen oxidase m:gblAF044128.11AF044128.
Chimere:gggaatagcggatgcgcatgcgcactctctggtgtcgtagactgcctacccggttaggactcatccttactggtcgtgaagac tgcgaactctgtgaggactcatcatcactggtctcgtagactgcgtacccggtcaggactcatcggtactggtctcgtagacagcttaccggc ctgggaaggttcttcgtgttatatcggtcatgattcatcaagcgcgaattctcc.
(8). Phosphoenolpyruvate carboxylase ID: splP27154.1.
Chimere:ggcgtattagcggcgcgaattcgcccttactggtctcgtagactgcgtaatcggtcaggactcatcactactggtctcgtagac tgcgtaccactggtctcgtagactgcgtactactggtctcgtagactgcatatcggtcaggactcatca.
(9). Photosystem 11 protein N: ID: NP 054528.1.
Chimere:ccttactggtctcgtagactgcgtacccggtcaggactcatcagtcaggactactggtctcgtagactgcgtacccggtcagg actcatcgctatatcggtcaggactcatca.
(10). 4-Coumarate:coenzyme A ligase. ID: dbjlD43773.11.
Chimere:gtgcaatacggncgcgaattcgcccttactggtctcgtagactgcgtacccgatcaggactcatcgctatatcggtcaggctc atcactatatcggtcaggactcatca.
(11). Peroxidase ID: dbjlAB044154.11.
Chimere:gggggaaaaaacgggcgcgaattcgcccttactggtctcgtagactgcgatatcggtcaggactcatcactactggtctcgt agactgcgtacccggtcaggactcatcgctactggtctcgtagactgcgtacccggtcaggactcatcgctatatcggtcaggactcatcata tcggtcaggactcatcaagggcgaattcgtttaaacctgcaggactagtccctttagtgagggttaattctgagcttggcgtaatcatggtcata gctgtttcctgtgtgaaattg.
(12). Beta-caryophyllene synthase ID: gblJQ731634.1.
(13). (+)-Epi-alpha-bisab0101 synthase ID: splJ7LH11.11.
(14). Bicyclogermacrene synthase ID: gblJQ731633.1.
(15). Alpha-copaene/delta-cadinene synthase ID:gb]JQ731632.11.
(16). Trans-alpha-bergamotene synthase ID: gblJQ731635.11.
(17). Bifunctional sesquiterpene synthase 1 ID: splJ7LP58.11.
(18). Geraniol synthase ID: gbIADK62524.1.
Chimere:gaggtaatagcggcgcgaattcgcccttactggtctcgtagactgcgtacccgatgcagaaggcgggaaaacatgaaatga gcgtcaagcaggccgtgaaggttgccgagcttttgaagtgcaacccgatggaggttatctgcggggtgatgtttcaccaggacgtaatgga gcgggatttctggacggacattttccagcagacagtcaccgaaaacgaccgccgccactacttcaagaaggtttaggcaggctttcggtca ggactcata.
(19). Prenyltransferase alpha-subunit ID: emblCD130233.11.
Chimere:ctggtctcgtagactgcgtacccgatgcagaaggcgggaaaacatgaaatgagcgtcaagcaggccgtgaaggttgccga gcttttgaagtgcaacccgatggaggttatctgcggggtgatgtttcaccaggacgtaatggagcgggatttctggacggacattttccagca gacagtcaccgaaaacgaccgccgccactacttcaagaaggtttaggcaggctttcggtcaggactcataagggcgaattcgtttaaacctg caggact.
______________________________________________________
When the non-homologous RNA sequences that flanked the homologous sequences were clipped out [16], and the complementary oligonucleotides were used as Northern probes, there was no recognition of the total RNA targets and there were no Northern bands [16]. Therefore, the total RNA degradation function by chimere is independent of the genetic code. Furthermore, the chemically synthesized probes [16] that corresponded to the chimerenomic-based probes did not give any Northern bands thereby revealing the chemical mechanism of the degradation of total RNA. The role of the flanking sequences is to direct, guide, and align the homologous sequence in the chimere to the target site in the homologous total RNA sequence. The G + C contents [12] of chimerenomic RNA are different from those of total RNA. Based on their different G + C contents, the electromagnetic properties of total RNA are different from those of chimerenomic RNA.
The chimerenomic-based probe (#4 Table 1) that is homologous to the mRNA encoding starch synthase is repeated five times in the range from nucleotide residue 110 - 651 of the mRNA. Sequence repeats are characteristics of chimerenomic RNA (Figure 1).
Legend
Figure 1: Structure of chimere showing its homologous alignments with mRNAs.
The matches and multiple repeats of the chimerenomic RNA within the zone of homology of the genetic code-based RNA probably facilitate homologous alignment reaction between the two types of RNA, and so make the machinery and chemistry of degradation completely different from the double-stranded RNA-mediated co-suppression post-transcriptional gene silencing that also embodies the participation of protein enzyme complexes (molecular biology) [12; 16]. When the chimere aligns to the homologous target genetic code-based RNA (Figure 1), the resulting electro-magnetic collision (electrostatic repulsion) between them leads to the degradation of the homologous genetic code-based RNA, which is the lesser stable of the two kinds of RNA (Figure 1). A similar alignment mechanism also exists between chimere #3 and the mRNA encoding cytochrome P-450 reductase (Table 1). There are nucleotide sequence differences between the segment of homology, the left flanking sequence, and the right flanking sequence, making each chimere beyond genetic code control, being completely specific for the degradation of one or more mRNAs (Figure 1). Removal of the structural constraint imposed by genetic code transformed mRNA to a fully-fledged RNA enzyme that is independent of genetic code for its chemical function. Genetic code-based nucleic acids are thermally less stable [16] than chimere. The failure of the chemically synthesized oligonucleotide to hybridize to the target total RNA sequence is evidence that base pairing hydrogen bonding is not the chemical mechanism of alignment and degradation of total RNA by chimere.
The alignment of chimere to the target genetic code-based RNA is by homologous sequence interaction, involving non-canonical base-pair formation between the two kinds of RNA. Non-Watson Crick base pairs of the types: AA, UU, GG, CC, AU, GU etc that are involved in homologous sequence alignment also include van der Waals, electrostatic, and solvation terms that are known to stabilize RNA structural motifs and their helix arrangements [16]. However, the non-canonical base-pair formation in homologous RNA alignment is weaker than Watson-Crick complementary hydrogen bonds, thus explaining the choice of low temperatures that were applied in the in vitro degradation of total RNA by chimerenomic RNA. Therefore, degradation of total RNA by chimerenomic RNA confirms nucleic acid chemistry. Furthermore, double-stranded RNAs (miRNA, siRNA, shRNA etc), RISH and RITS protein complexes that dominate RNA interference mechanisms were not involved in the chimere machinery (Figure 1). Homology-dependent gene silencing has been described but it focused on transgenes without explaining the chemical mechanism of silencing. The fact that total RNA degradation fragments formed RNA: DNA hybrids suggested that the degradation mechanism was neither depurination nor depyrimidination of total RNA.
5.0. Reprogramming of Arachis hypogaea total RNA abundance. Arachis hypogaea chimere # a (Table 2) shared sequence homologies with three mRNAs viz., ~12600 bases encoding the flavonoid regulator protein, 2100 bases encoding NADH dehydrogenase subunit 5, and ~1700 bases encoding ribosomal protein S3 [38; 39].
________________________________________________
Table 2: Reprogramming of Arachis hypogea total RNA abundances.
________________________________________________
a). Chimerenomic RNA probe for the mRNAs encoding flavonoid biosynthesis protein, ribosomal protein S3, and NADH dehydrogenase a).
gaacggcattgatagcgatgagttcctgaccgacaacggcattgatagcgatgagtcctcaccgacaacggcattgatagcgatg agtcctgaccgacaacggcattgatagcgatgagtcctgaccgacaacgcattgatacgatgagtcctgaccgg
b). Chimerenomic RNA probe for the mRNAs encoding translational factor and GSH S-transferase
gctggtaaggntggnctttaagtccgttgtgaaagcctgggcnccntctaganganctgcagtggaactgggcgactanagtgtgcccatanggtcccggaattcctggtgtagcagtgaaatgcgtatagatcaggaggaacntccatggcgaaggcagctacctggancancactgacactgaggcacgaaagcgtggggagccaacaggattagataccctggtagtccccgctctaaacgatgcnaatt
________________________________________
The band intensities in Figure 2 were quantified and normalized with reference to the control peanut as the baseline; and the up- or down-regulation of transcript mRNA abundances were compared semi-quantitatively [11].
Figure 2: Reprogramming Peanut total RNA abundance and metabolism by chimerenomic RNA.Equal amounts (10 pg) of total RNAs extracted from the control (lane 7), and from 4 NTPs (lane 1), 4NTPs-NH4C1 (lane 2), NH4C1 (lane 3), ATP (lane 4), 3NTPs (lane 5), CTP (lane 6), GTP (lane 8), I-JTP (lane 9), ATP-UTP (lane 10), GTP-CTP (lane 11) treatments of peanuts were electrophoresed through 2% agarose gel, trans-blotted onto nylon membrane, followed by screening with 32Plabelled cDNA of the chimerenomic RNA probe i, (Table 2). The membrane was washed with a low stringency solution and autoradiographed. The 3NTPs treatment was ATP+UTP+GTP solution (Osuji and Brown 2007).
The peanut was grown in eleven different environmental conditions. Screening the total RNA extracts from the peanuts with the chimerenomic RNA probe # a (Table 2) showed that the mRNAs encoding the flavonoid enzyme (biosynthesis), ribosomal protein S3 (translation), and NADH dehydrogenase (respiration) were present in the control peanut, but some of the mRNAs were either absent, down-regulated, or up-regulated in abundance in the treated peanuts. The UTP-treated peanut displayed the scantiest abundance of the three mRNAs (Figure 2) and accordingly produced the lowest biomass yield. The stoichiometric combinations of nucleophilic chemicals: 4 ribo-NTPs-NH4+ ion, ribo-ATP, 3 ribo-NTPs, ribo-CTP, ribo-GTP, and ribo-GTP/ribo-CTP treatments up-regulated the mRNA encoding NADH dehydrogenase, and they displayed the highest biomass yields. On the other hand, NH4Cl, ribo-ATP, UTP, and 4 ribo-NTPs treatments of peanut down-regulated the mRNA encoding ribosomal S3 protein. The combined ribo-GTP-ribo-CTP, CTP, and GTP treatments of peanut showed dominant co-up-regulation of the mRNAs encoding the flavonoid biosynthetic and NADH dehydrogenase proteins. Therefore, changes in the environmental conditions changed the chimeres (GDH-synthesized RNA enzymes), which changed the abundances of the mRNAs that are homologous to them, which in turn changed the abundances of the encoded protein enzymes leading ultimately to reprogramming of the metabolic processes associated with the prevalent environmental changes. This sequence of GDH-dependent environmental reprogramming of biological processes at the total RNA level could be important for controlling and treating chemical dependency.
6.0. Chimerenomic RNA in the Reprogramming of Drug Catabolism
Drugs and xenobiotic chemicals are degraded by an array of enzymes [40; 41; 42]. It is important to incorporate metabolism research early in the pre-clinical drug screening processes because poor pharmacokinetics account for a high proportion of clinical failures of drugs. The novel fields of RNAi and transgenic animal modeling are fast-forwarding the pace of toxicological studies. These issues call for continued development of innovative methodologies in the pharmacokinetic pre-clinical screening of potential drugs.
Genetic code-based nucleic acid probes and primers have supported the remarkable breakthroughs made by hybridization and polymerase chain reaction (PCR) techniques in genetic and genomic research. Since genetic code-based probes and primers are not necessarily metabolic in origin, the results derived from molecular biology experimentation in which they are utilized in the analyses may or may not represent the physicochemical effects of the environmental conditions studied. Furthermore, the pharmacokinetics of a potential drug is not yet predictable with much accuracy because the combination of enzymes under a specified state of ill-health that are upregulated to metabolize the drug is regularly changing. Therefore, there is need to develop specific environment-metabolic approach, different from the conventional metabolic-genetic approach for studying the responses of genes and diseases to administered drugs. Metabolic transformations of structurally related drugs are influenced by many variables including enzyme isoforms, cell types, age, physiology, gender etc [43; 44; 45]. Although drugs are designed to target specific macromolecules, no universal genetic-metabolic process that connects drug metabolism, disease, and genes has been described. This has hampered the rapid development of new drugs using the wealth of bioinformatics knowledge now available [46]. The molecular relationships between adverse drug reactions (drug overdose and addiction) [47] and many disease conditions that are exacerbated by genetic variations and single-nucleotide polymorphisms [48] have not been clearly understood. Therefore, it is important to understand the universal biological processes that connect the environmental conditions, drug metabolism, disease conditions, and genes. This calls for studies on drug metabolism at the molecular level in conjunction with pharmacokinetic studies. This review addresses the potential of the template-independent synthesis of RNA (Chigramming) by NADH-GDH [1; 36] in response to xenobiotic chemicals to be part of the universal biological processes that link the environmental conditions, gene expression, intermediary metabolic pathways, drug catabolism, and diseases [1].
To demonstrate the connection between chigramming, changes in the physicochemical environment, genes, drug degradation, and the intermediary biochemical pathways, the ribo-nucleoside triphosphates (ribo-NTPs) were selected as the strong nucleophilic drugs, with several subgroups of functionally related weak nucleophiles (ammonium ion, chitosan); and peanut seedlings as the experimental organism [1]. Peanut seeds germinate readily, and there are no agricultural regulatory agencies that prohibit their utilization as experimental organisms. Nucleotides are structurally and functionally related. Also, some of their analogues are HIV and viral DNA reverse transcriptase inhibitors [11] antihypertensives, antineoplastics, antiarrhythmics, antimetabolites etc [8]. Their pharmacokinetics and detoxication by the drug metabolizing enzymes have not been studied extensively. Eight different concentrations (mM) and in different combinations of the ribo-NTPs; 2% chitosan solution (biochemical regulator), and a mixed combination with NH4+ ion was established including an untreated control [11] as the different environmental conditions.
The chimerenomic RNA probe (Table 2) for the mRNAs encoding translational factor (~6,500 bases long) and glutathione s-transferase (~850 bases long) was applied for screening the total RNA extracts (Figure 3).
Figure 3: Reprogramming Peanut total RNA abundance and drug catabolism by chimerenomic RNA. Equal amounts (10 ug) of total RNAs extracted from the control (lane 7), and from 4 NTPs (lane 1), chitosan (lane 2), ATP (lane 3), NH4C1 (lane 4), 3NTPs (lane 5), CTP (lane 6), GTP (lane 8), UTP (lane 9), ATP-UTP (lane 10), GTP-CTP (lane 11) treatments of peanuts were electrophoresed through 2% agarose gel, trans-blotted onto nylon membrane, followed by screening with 32Plabelled cDNA of the chimerenomic RNA probe ii, (Table 2). The membrane was washed with a low stringency solution and autoradiographed. The high mol. wt. band is the mRNA encoding translational factor; the lower mol. wt. band is the mRNA encoding the glutathione s-fransferase (Osuji et al., 2008).
The mRNA encoding the GST was upregulated in the 4NTPs, chitosan, and ATP treatments but was downregulated in all the other treated peanuts. The mRNA encoding the translational factor was detected in the peanuts treated with 4NTPs, ATP, ammonium chloride, 3NTPs, CTP, GTP, and GTP-CTP but was absent from the other treated peanuts. The downregulation of the abundance of the mRNA encoding the GST implied that the peanuts treated with ammonium chloride, 3NTPs, CTP, GTP, UTP, ATP-UTP, GTP-CTP including the control would be deficient in the activity to catabolize drugs and xenobiotics. This is a typical illustration of the reprogrammed abundance of the mRNA encoding an enzyme by chimerenomic (GDH-synthesized) RNA, followed by the resetting of the associated biochemical pathways and biological processes of the organism. The trend in the decrease of the abundances of the mRNAs encoding GST, and translational factor agreed with the trend in the decrease of the total RNA contents, which in turn agreed with the trend in the decrease in GDH-chimerization (Figure 3) [8]. Every change of the environmental condition was followed by changes in GDH-chimerization, total RNA content, and mRNA abundance (Figure 3). These and other results [11] showed that the abundance of the mRNAs encoding the phase I enzymes was reprogrammed by chimerenomic RNA. The abundance of the mRNA encoding GST (phase II) was linked to the abundance of the mRNAs encoding the enzymes of phase I by chimerenomic RNA. GSTs of higher plants show a high degree of structural homology to animal GSTs [49]. They function to protect the cell from oxidative damage by quenching reactive molecules (pesticides, drugs, and carcinogens) with the conjugation of GSH [50]. However, they are known to possess broad substrate specificities [51]. As is common in GDH chigramming, there are also tissue location differences in GST. The GST purified from rat liver microsome was stimulated eightfold by the treatment with N-ethylmaleimide and fourfold with iodoacetamide; whereas the soluble enzyme of rat liver cytoplasm was not affected by such sulfhydryl-blocking agents [52]. Assays of GSTs are major experimental activities in the pharmacokinetic screening of potential dermatological drugs [53]. Therefore, the results derived from plant GST could be applied as a model for drug screening in homo sapiens studies. These reprogramming of mRNA abundance suggested that chimerenomic RNA catalyzed the biological processes that connected gene expression, drug metabolism, and the environmental conditions.
Northern blotting was preferred to microarray and/or PCR techniques because the chimerenomic RNAs studied were multi-target probes that required the fractionation of the mRNAs prior to probing [11]. Exploratory Northern analyses that were performed to verify the interaction of chimerenomic RNA with the several putative targets in mRNAs displayed multiple bands [1, 11]. In each Northern blot, the band patterns and intensities of the control peanut total RNA were taken as the baseline [11]. The Northern bands were distinct and compact without any smearing, thus confirming that the total RNA preparations were free from ribonuclease degradation. The rRNA bands were present as evidenced in the photographed gels thus confirming that total RNA preparations used were free of any degradation. By being multi-targeted, the chimerenomic RNA probes simultaneously identified several mRNAs thus proving that they are not restricted by genomic and genetic structural barriers.
7.0. Functions of Chimerenomic RNA of cowpea (Vigna unguiculata):This section discusses the occurrence of GDH chigramming (conversion of the prevalent environmental conditions to the nucleotide sequences of chimeres and NTintis) in vivo during normal tissue growth and development in the control unfertilized cowpea. Extensive primary research on the GDH-chimmerization, chimeres, NTintis, and functional chimerenomics showed that cowpeas that were fertilized with nucleophilic combinations of mineral ion salts (N, P, K, and S) out-yielded other cowpeas that were cultivated on farmers’ field plots by a staggering 496% [19]. For the functional chimerenomic analyses to identify the chimerenomic RNAs that were homologous to genetic code-based RNAs (total RNA), the cDNA sequences of the chimerenomic RNAs were used as queries to search the NCBI nucleotide-nucleotide (excluding ESTs) BLAST (blastn), and non-redundant protein translation (blastx) databases. The BLAST searches showed that all the NTintis (GDH-synthesized RNA) matched known-function genes (Table 3) covering all biological categories including but not limited to environmental stress, transport, transcription, translation, signaling, respiration, metabolism, biosynthesis, cell growth etc.
Table 3: Functional Chimerenomics: Enzymes, mRNAs, and cDNA sequences of chimeres homologous to the mRNAs of Control Untreated Cowpea (Vignia unguiculata).
|
Chimeres (S/N) |
cDNAs of Chimeres (RNA Enzyme synthesized by GDH) |
mRNAs Homologous to the Chimeres (RNA Enzymes) |
|
1 |
ctggtctcgtagactgcgtacccggtcaggactcatcgctactggtctcgtagac tgcgtaatcggtcaggactcatcactactggtctcgtagactgcgtaccagcctg gtaaggttcttcgcgttgattcggtcaggactcataa |
a).NADH-plastoquinone oxidoreductase : ref|YP_006460330.1|; b).Phenylalanine ammonia-lyase gb|AAD45384.1|; c).Phosphoribosylformylglycinamidine cyclo-ligase : sp|P52424.1|PUR5_VIGUN; d).Phosphoribosylpyrophosphate amidotransferase : gb|AAC24007.1| |
|
2 |
actggtctcgtagactgcgtaccggcctggtaaggttcttcgcgttga
ttcggtcaggactcat
|
a).Alternative oxidase gb|ABM66368.1|; b).Dehydrin gb|AF159804.1|AF159804; c).Formylglycinamide ribonucleotide amidotransferase gb|AAL55431.1|; d).Phenylalanine ammonia-lyase gb|AAD45384.1|; e).Phosphoribosylpyrophosphate amidotransferase gb|AAC24007.1|. |
|
3 |
gggtcatagcggcgcgaaatcgcccttatgagtcctga ccgaatcaacgcgaagaaccttaccaggccggtacgc agtctacgagaccagtagtgatgagtcctgaccgatt acgcagtctacgagaccagtagctatgagtcctgacc gaatccgggtacgcagtctacgagaccagtaa |
a).Calcium exchanger protein gb|JQ731678.1|; b).Digalactosyldiacylglycerol synthase : gb|ABA55727.1| c).Glutathione reductase : gb|DQ267474.1| d).NADH-plastoquinone oxidoreductase ref|YP_006460330.1|; e).Sulfoquinovosyldiacylglycerol synthase: gb|DQ205522.1| |
|
4. |
ggtaattgcgggcgcgaattcgcccttactggtctcgtaga ctgcgtaccggcctggtaaggttcttcgcgttgattcggtca ggactcata |
a).Alternative oxidase gb|ABM66368.1|; b).Ascorbate peroxidase (chloroplast stroma) gb|AAS55853.1|; c).Ascorbate peroxidase (chloroplast thylakoid) : gb|AAS55852.1|; d).Cytochrome b6 : ref|YP_006460372.1|; e).Formylglycinamide ribonucleotide amidotransferase (pur4) gb|AAL55431.1|; f).NADH-plastoquinone oxidoreductase ref|YP_006460330.1|; g).Phenylalanine ammonia-lyase gb|AAD45384.1|; h).Phosphoribosylpyrophosphate amidotransferase gb|AAC24007.1|; i).Starch synthase emb|CAB40374.1| |
|
5 |
actggtctcgtagactgcgtacccgaatggattggaaagga atagaatggaatggaatggaatcgactcaaatggaatggac tagaatggaatggattcggtcaggactcata
|
a).Aminoimidazole ribonucleotide synthase (pur5) gb|U30895.1|VUU30895; b).Ascorbate peroxidase gb|AAS46016.1|; c).Ascorbate peroxidase (chloroplast stroma) gb|AY484493.1|; d).Asparagine synthase dbj|BAM93579.1|; e).Glycin-rich protein emb|X87948.1|; f).Phenylalanine ammonia-lyase gb|AAD45384.1|; g).Glycinamide ribonucleotide synthase (pur2) gb|U30896.1|VUU30896; h).Phenylalanine ammonia-lyase : gb|AF165998.1|AF165998; i).Phosphoribosylpyrophosphate amidotransferase (pur1) gb|AF071862.2|; j).Ribulose-bisphosphate carboxylase/oxygenase gb|AER24546.1|; k).Starch synthase emb|AJ225088.1|; l).Vicilin : emb|AM905848.1|; m). Asparagine synthase dbj|AB779664.1| n). Isoflavone synthase 2 : gb|EU737111.1| |
|
6. |
ataaggggtctttgcgggcgcgtatcgccgtattgagtcctgaccgaat caacgcgaagaaccttaccaggccggtacgcagtctacgagacc agtagtatgagtcctgaccgattacgcagtctacgagaccagtagct atgagtcctgaccgaatccgggtacgcaatc aacgagaccag |
a).Apoprotein A2 P700 photosystem 1 ref|YP_006460336.1|; b).Aspartic proteinase gb|AF287258.1|; c).Cytochrome b6 ref|YP_006460372.1|; d).Glutathione reductase gb|DQ267474.1|. |
|
7. |
ataaggggtctttgcgggcgcgtatcgccgtattgagtcctgaccgaatcaacgcg aagaaccttaccaggccggtacgcagtctacgagaccagtagtgatgagtcctgacc gattacgcagtctacgagaccagtagctatgagtcctgaccgaatccgggtacgcaat caacgagaccagtaag |
a).Calcium exchanger protein gb|KC404642.1|; b).Glutathione reductase gb|DQ267474.1|; c).Starch synthase : gb|ABP35818.1|
|
|
8. |
gggtatagcggncgcgnattcgcccttactggtctcgtagactgcg tacccgatgcagaaggcgggaaaacatgaaatgagcgtcaagca ggccgtgaaggttgccgagcttttgaagtgcaacccgatggaggt tatctgcggggtgatgtttcaccaggacgtaatggagcgggattt ctggacggacattttccagcagacagtcaccgaaaacgaccgcc gccactacttcaagaaggtttaggcaggctttcggtcaggactcataa |
a).Aminoimidazolecarboximide ribonucleotide- transformylase/ inosine monophosphate cyclohydrolase gb|AY193836.1|; b).Glycinamide ribonucleotide synthetase (pur2) gb|U30896.1|VUU30896; c).Isoflavone synthase gb|EU616499.1|; d).Shatterproof-like protein gb|AEO89558.1| |
|
9. |
gcgtaataggcggcgcgaattcgcccttactggtctcgtagactgcgta cccgatgcagaaggcgggaaaacatgaaatgagcgtcaagcaggccg tgaaggttgccgagcttttgaagtgcaacccgatggaggttatctgcgg ggtgatgtttcaccaggacgtaatggagcgggatttctggacggacatt ttccagcagacagtcaccgaaaacgaccgccgccactacttcaagaag gtttaggcaggctttcggtcaggactcata
|
a).Aminoimidazolecarboximide ribonucleotide- transformylase/ inosine monophosphate cyclohydrolase gb|AY193836.1|; b).Apyrase dbj|AB196770.1|; c).Glycinamide ribonucleotide synthetase (pur2) gb|U30896.1|VUU30896; d).Glycinamide ribonucleotide tranformylase (pur3) gb|AY189138.1|; e).Shatterproof-like protein gb|AEO89558.1|; f).Starch synthase gb|ABP35818.1|. |
|
10. |
ggctaatagcggcgcgaattcgcccttatgagtcctgaccgaatcaacg cgaagaaccttaccaggccggtacgcagtctacgagaccagt
|
a).Drought inducible protein dbj|D83972.1|; b).Formylglycinamide ribonucleotide amidotransferase gb|AAL55431.1|; c).Fructokinase : gb|HM211406.1|; d).Phenylalanine ammonia-lyase gb|AAD45384.1|; e).Phosphoribosylpyrophosphate amidotransferase gb|AAD45384.1| f).Apyrase dbj|BAD80836.1| g).?-ATP synthase sp|Q2LGZ2.1|ATPG_VIGUN h). Ferric leghemoglobin reductase gb|AF181096.1|AF181096 |
|
11. |
ggggaatagcgggcgcgtattcgcccttactggtctcgtagactgcgtacccgatg cagaaggcgggaaaacatgaaatgagcgtcaagcaggccgtgaaggttgccgag cttttgaagtgcaacccgatggaggttatctgcggggtgatgtttcaccaggacgtaa tggagcgggatttctggacggacattttccagcagacagtcaccgaaaacgaccgc cgccactacttcaagaaggtttaggcaggctttcggtcaggactcataa |
a).Isoflavone synthase 1 gb|EU737110.2|
|
|
12. |
gcgtcatagcggcgcgaattcgcccttactggtctcgtagactgcgtacccgatgcag aaggcgggaaaacatgaaatgagcgtcaagcaggccgtgaaggttgccgagctttt gaagtgcaacccgatggaggttatctgcggggtgatgtttcaccaggacgtaatgga gcgggatttctggacggacattttccagcagacagtcaccgaaaacgaccgccgcca ctacttcaagaaggtttaggcaggctttcggtcaggactcataa
|
a).Apyrase: gb|AF156781.1|AF156781; b).Carbonic anhydrase: gb|JQ429799.2|; c).4-Coumarate:coenzyme A ligase 7 : gb|KF303292.1|; d).Glycine-rich cell wall protein 1.8 emb|X13596.1|; e).Glycinamide ribonucleotide synthase (pur3) gb|AF160196.2|; f).Isoflavone synthase 1: gb|EU737110.2| |
|
13. |
ggatatagcggncgcgnattcgcccttactggtctcgtagactgcgtacccggtcag gactcatcgcttctggtctcgtagactgcgtaatcggtcaggactcatcactactggtc tcgtagactgcgtaccggcctggtaaggttcttcgcgttgattcggtcaggactcataag |
Glutathione reductase gb|DQ267474.1| |
|
14. |
gggtcatagcggcgcgaattcgcccttatgagtcctgaccgaaagctatgagtcc tgaccgagtacgcagtctacgagaccagtagcgatgagtcctgaccgggtacgca gtctacgagaccagta |
a).Calcium exchanger protein gb|JQ731678.1|; b).Delta 1-pyrroline-5-carboxylate synthase dbj|AB518058.1|; c).Glutathione reductase gb|DQ267474.1|. |
|
15. |
gggtaaatagcggcgcgaattcgcccttactggtctcgtagactgcgtacccgatgca gaaggcgggaaaacatgaaatgagcgtcaagcaggccgtgaaggttgccgagcttt tgaagtgcaacccgatggaggttatctgcggggtgatgtttcaccaggacgtaatgg agcgggatttctggacggacattttccagcagacagtcaccgataacgaccgccgcc actacttcaagaaggtttaggcaggctttcggtcaggactcataa |
a).Apyrase gb|AF156781.1|AF156781; b).Extensin emb|X91836.1|; c).Lectin precursor emb|AJ621421.1| |
|
16. |
gggtaatagcggcgcgaattcgcccttactggtctcgtagactgcgtact cggtcaggactcatcgctactggtctcgtagactgcgtacccggtcagga ctcgtcactactggtctcgtagactgcgtaccggcctggtaaggttcttc gcgttgattcggtcaggactc |
a).Phosphoenolpyruvate carboxylase gb|ACO48250.1|; b).Triacylglycerol lipase 1 gb|ADY38373.1| |
|
17. |
gcgtgatagcggcgcgaaatcgcccttactggtctcgtagactgcgtacccgatg cagaaggcgggaaaacatgaaatgagcgtcaagcaggccgtgaaggttgccga gcttttgaagtgcaacccgatggaggttatctgcggggtgatgtttcaccaggacg taatggagcgggatttctggacggacattttccagcagacagtcaccgataacga ccgccgccactacttcaagaaggtttaggcaggctttcggtcaggactcataa |
a).Apyrase gb|AF156781.1|AF156781; b).Drought inducible protein : dbj|D83970.1|; c).Isoflavone synthase 1 gb|EU737110.2|; d).Lectin precursor emb|AJ621421.1| |
|
18. |
gggtatagcggncgcgcattcgcccttatgagtcctgaccgaatcaacgcgaagaa ccttaccaggccggtacgcagtctacgagaccagta
|
a).Cytochrome b6 gb|AEP94890.1|; b).Formylglycinamide ribonucleotide amidotransferase gb|AAL55431.1|; c).NADH-plastoquinone oxidoreductase ref|YP_006460330.1|; d).Phenylalanine ammonia-lyase gb|AAD45384.1|; e).Phosphoribosylpyrophosphate amidotransferase gb|AAC24007.1| f). Xeaxanthin epoxidase (CpABA1): dbj|AB030295.1|; dbj|BAB11934.1| |
|
19. |
actggtctcgtagactgcgtacccgaatgggttggaaaggaatagaatggaatggaa tggaatcgactcaaatggaatggactagaatggaatggattcggtcaggactcataa
|
a).Aminoimidazole ribonucleotide carboxylase gb|AAL48287.1|AF4524951; b).Ascorbate peroxidase : gb|AAS46016.1|; c).Asparagine synthase : dbj|BAM93579.1|; d).Carbonic anhydrase gb|AFX73760.1|; e).Phenylalanine ammonia-lyase gb|AAD45384.1|; f).Ribulose-bisphosphate carboxylase/oxygenase gb|AER24546.1|; g).Starch synthase : emb|CAB40374.1| h). Xeaxanthin epoxidase (CpABA1) dbj|BAB11934.1| |
The mRNAs, rRNAs etc that shared homologies with the chimeres (GDH-synthesized RNA enzyme) encoded enzymes that catalyzed reactions in different biological processes [1, 19].
GDH has a non-allelic gene structure [54]. It is made up of three different subunit polypeptides. The gene (GDH1) encoding the more acidic subunits (A and α) is heterozygous, and co-dominant; and the gene (GDH2) encoding the less acidic subunit (β) is homozygous [54].The binomial distribution pattern of the 28 GDH hexameric isoenzymes [10; 13] is a protein population array that displays the subunit relationships among the isoenzymes in the horizontal as well as in the vertical directions on the neutral acrylamide gel electrophoresis landscape.
Chimerenomic RNA synthesized by GDH aligns with its homologous mRNAs, rRNAs, transfer RNAs etc (genetic code-based RNA) to degrade them because chimerenomic RNA is more thermostable than genetic code-based RNA [12; 16]. Homologous RNA strands are held together by hydrophobic forces including van der Waal’s forces, non-Watson Crick bonds etc [55]. Therefore, the removal of the structural constraints imposed by genetic code transforms RNA to a fully-fledged RNA enzyme that is independent of genetic code for its chemical function [12].
cDNA (RNA) chimere #1 (Table 3) shared sequence homologies with four mRNAs encoding NADH plastoquinone oxidoreductase that catalyzes the Photosystem II light harvesting reaction in oxygenic photosynthesis [56]; phophoribosylformylglycinamidine cyclo-ligase that transports single-carbon groups in folate, methionine, and cysteine biosynthesis [57]; phenylalanine ammonia-lyase; and phosphoribosyl pyrophosphate amidotransferase. Phospho ribosyl pyrophosphate is utilized in the biosynthesis of purine and pyrimidine nucleotides, the amino acids histidine and tryptophan, and the cofactor nicotinamide adenine dinucleotide [58]. Phenylalanine ammonia-lyase (PAL) catalyzes the nonoxidative deamination of phenylalanine to form ammonium ion and trans-cinnamic acid, the entry step for the channeling of carbon from primary metabolism into phenylpropanoid secondary metabolism in plants. PAL enables plants to respond to environmental stimuli [59]. Chimerem #1 controls the abundance of all the mRNAs that share sequence homology with it. Regulation of the abundance of genetic code-based RNAs by chimerenomic RNAs has similarly been demonstrated to reprogram biological processes in peanuts [1; 2; 12; 16; 31; 32; 34].
Chimere #2 shared sequence homologies with five mRNAs encoding alternative oxidase, dehydrin, formylglycinamide ribonucleotide amidotransferase of the purine biosynthetic pathway [60], phenylalanine ammonia-lyase, and phosphoribosylpyrophosphate amidotransferase. Alternative oxidase catalyzes cyanide-resistant reduction of oxygen to water without translocation of protons across the inner mitochondrial membrane, and thus functions as a non-energy-conserving component of the respiratory electron transfer chain (61]. Dehydrins are membrane proteins that reduce electrolyte leakage from cowpea seedlings thereby conferring low temperature tolerance [62].
Chimere # 3 shared sequence homologies with five mRNAs encoding calcium ion exchanger protein, NADH plastoquinone oxidoreductase, digalactosyldiacylglycerol synthase,
sulfoquinovosyldiacylglycerol synthase, and glutathione reductase. Calcium ion exchanger protein regulates the concentration of calcium ions in cowpea roots in relation to soil calcium ion concentrations [63]. Digalactosyldiacylglycerol is a chloroplast precursor in the middle lamellar prothylakoids membrane systems complexed with NADPH light-dependent oxidoreductase [64]. Sulfoquinovosyldiacylglycerol and phosphatidylglycerol are major classes of the thylakoid membrane lipids in higher plant chloroplasts where they are essential for photosynthesis and growth. [65]. Glutathione/glutathione disulfide (GSH/GSSG) redox buffer provides homeostasis by maintaining the redox state of other thiol compounds, avoiding their unnecessary oxidation and thus keeping them in the reduced state. GSH also detoxifies xenobiotics, sequesters heavy metals involved in environmental stress tolerance [66].
Chimere #4 shared homologous sequences with nine different mRNAs encoding alternative oxidase, ascorbate peroxidases, formylglycinamide ribonucleotide amidotransferase, NADH plastoquinone oxidoreductase, phenylalanine ammonia-lyase, cytochrome b6, starch synthase, and phosphoribosylpyrophosphateamidotransferase. Starch is an insoluble polymer of glucose residues and is a major storage product of seeds and storage organs produced agriculturally and used for human consumption. Transient starches synthesized in leaves in the day are hydrolyzed at night to provide carbon for non-photosynthetic metabolism [11; 67]. Cytochrome b6 complex balances the photosynthetic production of ATP and NADPH with their metabolic consumption in the Calvin–Benson cycle and the subsequent reactions of primary metabolism [39].
Chimere #5 was homologous to thirteen mRNAs encoding ascorbate peroxidases, aminoimidazole ribonucleotide synthase, asparagine synthase, glycine-rich protein, phenylalanine ammonia-lyase, glycinamide ribonucleotide synthase, starch synthase, phosphoribosyl pyrophosphateamido transferase, ribulose-bisphosphate carboxylase/oxygenase, vicilin, and isoflavone synthase. Chimere #5 was repeated five times in the mRNA encoding glycine-rich protein; two times in the mRNA encoding starch synthase; and two times in the mRNA encoding aminoimidazole ribonucleotide synthase. These repeat matches within the length of a mRNA make for fail-proof alignment in the intermediate enzyme:substrate [Chimere:mRNA] complex [16]. Aminoimidazole ribonucleotide synthase is one of the ten enzymes involved in purine biosynthesis [60]. Asparagine plays a central role in nitrogen storage and transport in higher plants due to its high ratio of nitrogen to carbon and its unreactive nature. It accumulates to high concentrations during seed germination and in response to abiotic and biotic stresses [68]. Glycine-rich proteins are accumulated in the vascular tissues and their synthesis is part of the plant’s defense mechanism [69]. Glycinamide ribonucleotide synthase is involved in purine and pyrimidine nucleotide biosynthesis [70]. Ribulose-bisphosphate carboxylation is the major rate determining reaction in photosynthetic CO2 assimilation. All factors that influence the photosynthetic rate do so by influencing the activity of ribulose-bisphosphate carboxylase /oxygenase and the concentration of its substrates, CO2 and ribulose-bisphosphate [71]. Vicilins, also called 7S globulins are storage proteins and can constitute as much as 70 to 80% of total seed protein. They are cleaved into smaller fragments before and during the germination process and may play defensive roles in germinating seeds [72]. Isoflavones in the rhizosphere soil induce the expression of rhizobial Nod genes, which initiate the formation of the nodules that fix nitrogen. In addition, isoflavones act as antimicrobial phytoalexins and modulate rhizosphere microbial communities, which have been suggested to play important roles in plant growth and crop yield [73].
Chimere #6 was homologous to the mRNAs encoding apoprotein A2 P700 photosystem 1, aspartic proteinase, cytochrome b6, and glutathione reductase. Photosystem I mediate light-driven electron transfer from plastocyanin to ferredoxin and is involved in light energy conversion by balancing linear and cyclic electron transport in photosynthesis [74]. Aspartate proteinase is involvement in protein processing and degradation under different conditions and in different stages of plant development suggests some stress-related functional specialization [75].
Chimere #7 shared sequence homology with three mRNAs encoding calcium ion exchanger protein, glutathione reductase, and starch synthase.
Chimere #8 shared sequence homology with four mRNAs encoding aminoimidazolecarboximide rionucleotide transformylase/inosine monophosphate cyclohydrolase, isoflavone synthase, glycinamide ribonucleoside synthetase, and shatterproof-like protein. Control of pod shattering trait was an important trait and step that led to the domestication of cowpea, a protein-rich staple crop of the world [76].
Chimere #9 shared sequence homology with six mRNAs encoding shatter-proof-like protein, granule-bound starch synthase, apyrase, glycinamide ribonucleotide transformylase, and aminoimidazolecarboximide rionucleotide transformylase/inosine monophosphate cyclohydrolase. This chimere was repeated two times in the mRNA encoding apyrase. Apyrase is localized in the plasma membrane. Its nucleoside triphosphate diphosphohydrolase activity stimulates nodulation in legumes by regulating nucleotide concentration in the extracellular matrix [77]. Aminoimidazolecarboximide ribonucleotide is used in the synthesis of the purine ring in plant cells because the products, AMP and GMP, provide purine bases for DNA and RNA, as well as for several essential coenzymes (NAD, NADP, FAD, and coenzyme A) and signaling molecules. ATP serves as the energy source for many chemical reactions. Also, in plants, nucleotides are the precursors for purine alkaloids, and for the adenine moiety of cytokinin, the plant growth regulator [78].
Chimere #10 shared sequence homology with eight mRNAs encoding drought inducible protein, apyrase, formylglycinamide ribonucleotide amidotransferase, fructokinase, phenylalanine ammonia-lyase, phosphoribosylpyrophosphate amidotransferase, gamma-ATP synthase, and ferric leghemoglobin reductase. Drought inducible protein protects cowpea cell wall during dehydration, and high-salinity stresses. Abscisic acid levels rose 160 times in the drought-stressed cowpeas [79]. Leghemoglobin is the heme-containing protein that reversibly binds and transports O2 into the N2-fixing nodules of leguminous plants. To function as an O2-carrier, leghemoglobin is in the ferrous oxidation state. Oxygenated leghemoglobin readily autoxidizes to ferric leghemoglobin releasing the reactive O2− for the symbiotic metabolism [80].
Chimere #11 shared sequence homology with a mRNA encoding isoflavone synthase.
Chimere #12 shared sequence homology with six mRNAs encoding apyrase, carbonic anhydrase, coumarate coenzyme A ligase, glycine-rich cell wall protein, isoflavone synthase, and glycinamide ribonucleotide synthase. Carbonic anhydrase catalyzes the reversible hydration of CO2 in photosynthesis. It establishes the required inorganic carbon species equilibration so that the slow, uncatalyzed rate of CO2/HCO3- interconversion does not limit the rate of photosynthesis [81].
Chimere #13 shared sequence homology with the mRNA encoding glutathione reductase.
Chimere # 14 shared sequence homology with three mRNAs encoding calcium ion exchanger protein, delta 1-pyrroline-5-carboxylase synthase, and glutathione reductase. A bifunctional enzyme, delta-1-pyrroline-5-carboxylase synthase catalyzes the first two steps in proline biosynthesis in plants. Drought is among the most important environmental factor that causes osmotic stress and impacts negatively on plant growth and crop productivity. To counter this stress, many plants increase the osmotic potential of their cells by synthesizing and accumulating compatible osmolytes such as proline and glycine betaine [82].
Chimere #15 shared sequence homology with three mRNAs encoding apyrase, extensin, and lectins. Extensins are the self-assembling amphiphiles that generate scaffolding networks and pectic matrix for the physiological formation of cell wall [83]; and observed in rhizobium-cowpea interaction [84]. Lectins are carbohydrate-specific proteins for signal recognition and communication across the cell wall [85].
Chimere #16 shared sequence homology with two mRNAs encoding phosphoenolpyruvate carboxylate, and triacylglycerol lipase. Phosphoenolpyruvate is the starting intermediate for the biosynthesis of tryptophane, phenylalanine, and tyrosine [86]. Triacylglycerol protects plants from fungi and insect pests.
Chimere #17 was homologous to four mRNAs encoding apyrase, drought inducible protein, isoflavone synthase, and the enzyme for lectin biosynthesis.
Chimere # 18 shared sequence homology with six mRNAs encoding cytochrome b6, formylglycinamide ribonucleotide amidotransferase, NADH-plastoquinone oxidoreductase, phenylalanine ammonia lyase, phosphoribosylpyrophosphate amidotransferase, and xeaxanthin epoxidase.
Chimere #19 shared sequence homology with eight mRNAs encoding aminoimidazole ribonucleotide carboxylase, ascorbate synthase, asparagine synthase, carbonic anhydrase, starch synthase, phenylalanine ammonia-lyase, ribulose-bisphosphate carboxylase/oxygenase, and xeaxanthin epoxidase. Zeaxanthin epoxidase plays an important role in the xanthophyll cycle and abscisic acid biosynthesis. It converts zeaxanthin into antheraxanthin and subsequently violaxanthin. It is required for resistance to osmotic and drought stresses, regulation of seed development and dormancy, modulation of defense gene expression and disease resistance, and non-photochemical quenching in cowpea [87].
All the above metabolic networks of the cowpea show that chimeres (RNA enzyme) covered the entire biochemical and physiological pathways, degrading superfluous mRNA, rRNA, transfer RNA etc to reprogram the catabolic and anabolic processes for the efficient survival in the stressful arid environmental conditions in which it is usually cultivated.
The RNA enzymes (Table 3) are short oligonucleotides that shared sequence homologies with one or more different mRNAs. When environmental conditions are inadequate (application of inappropriate commercial fertilizer composition and rates, extreme temperature, drought, low soil organic carbon contents, biotic factors etc), the GDH hexamers chigrammed and chimmerize a lot of chimeres (RNA enzyme) that degraded the superfluous homologous mRNAs encoding most of the unnecessary regulatory enzymes, thereby discriminating the biochemical pathways; and the crop yield is low. Conversely, when the environmental conditions are excellent (stoichiometric mineral nutrients, healthy soil, normal temperatures, and rain fall etc), the GDH hexamers chigrammed and chimmerized only some chimeres so that most of the biochemical pathways remain functional and integrated to double and maximize the nutritious crop yield [34].
The RNA synthesized by GDH, being nongenetic code-based, is not subject to the biological and physical constraints imposed by genetic code [12]. Complete freedom from the molecular restrictions of the genetic code empowers the chimerenomic RNA to be thermally stable, and to exercise chemical functions of RNA enzyme to degrade homologous genetic code-based RNA (total RNA). Other known RNA enzymes are different, being genetic code-based RNA hydrolyzing genetic code-based RNA through Watson-Crick base pairing mechanism; therefore, their scopes are limited. The enzymatic activities of chimerenomic RNAs in peanut have been demonstrated in vivo, and in vitro, deduced from the modeling of the coordinated complex networks of GDH chemical pathways [9; 33]. The chimerenomic RNAs chimmerized by any group of peanut GDH isoenzymes completely degraded all the total RNA substrate under in vitro organic chemistry reaction condition. Total RNA is a complex mixture of the transcriptome. Therefore, the degradation of entire total RNA is evidence that GDH isoenzymes chimmerized an equally complex mix of chimerenomic RNA enzyme to control the abundance of entire transcriptome. The degradation of total RNA by chimerenomic RNA enzyme is a crowding (mass action) phenomenal chemical reaction whereby thousands of different chimerenomic RNA enzyme sequences attack their respective homologous genetic code-based RNAs simultaneously and non-synchronously [16]. All the chimerenomic RNA enzymes (Table 3) constitute the phenomenal new paradigm in molecular chemistry.
8.0. Chimerenomic Control of the Biological Processes of Untreated Cowpea. Cowpea dry grain is a global staple food that supplies cholesterol-free high quality dietary protein and many other healthy nutrients; but its yields are very low in the field plots of limited resources farmers [19]. In an elaborate chimerenomic-based project, purple hull cowpea was treated with 28 different stoichiometric mineral salts mixes including untreated control to understand the scientific bases of the low grain yield. The untreated control gave the lowest grain yield of the 28 chimerenomic environmental treatments. Therefore, chimerenomic RNAs were prepared from the control cowpea grains, and their functional chimerenomics were determined (Table 3).
The control cowpea GDH isoenzymes chigrammed a complicated mix of chimerenomic RNAs (Table 3) that were homologous to many mRNAs encoding regulatory enzymes that spread over a network of indispensable physiological functions including but not limited to cowpea growth, yield, and photosynthesis; saccharide, storage protein, drought resistance, nitrogen fixation, cell wall, purine/pyrimidine, amino acid, antioxidant etc metabolic processes. The presence of chimeres and NTintis that degraded the mRNAs encoding the enzymes in the above listed biological processes with the attendant reprogramming and down-regulation of overall anabolism explain the scientific root-cause of the control cowpea low grain yield.
Photosynthesis: The chimerenomic RNA enzymes are deeply entrenched in the global integration of cowpea photosynthesis at the total RNA level that (i) influence the concentrations of ribulose-bisphosphate and CO2 (ribulose-bisphosphate carboxylase/oxygenase); (ii) the light-driven cyclic electron transfer from plastocyanin to ferredoxin in Photosystem I (apoprotein A2 P700); (iii) oxygenic photosynthesis of Photosystem II (NADH plastoquinone oxidoreductase); (iv) middle lamellar chemical organization of chloroplasts (digalactosyldiacylglycerol synthase); (v) chemical storage of photosynthate starch, a food product for which cowpea was domesticated (starch synthase); (vi) balancing of substrate level ATP and NADPH production in photosynthesis with their utilization in the Calvin-Benson cycle (cytochrome B6 complex); (vii) equilibration of CO2 and bicarbonate ion concentrations and making them readily available in photosynthesis (carbonic anhydrase). The mRNAs encoding the enzymes that regulated the above photosynthetic steps were degraded by chimeres nos. 4, 5, 7, 9, 10, and 19 (Table 3) leading to the reprogramming and down-regulation of metabolism.
Growth and Yield: GDH isoenzymes repeatedly chigrammed chimeres nos. 5, 8, 11, and 17 (Table 3) that shared sequence homology with the mRNA encoding isoflavone synthase. Since isoflavone synthase regulates crop growth and yield [73], it is probably the trait that determines the earliness of cowpea maturity. Chimeres nos. 5, 8, 11, and 17 downregulated the abundance of the mRNA encoding isoflavone synthase thereby reprogramming control cowpea maturity and consequently the dry grain yield. The cowpea improvement programs [88] did not identify the trait controlling the earliness of grain maturity in the plots of limited resources farmers.
Saccharide metabolism: Control cowpea GDH also exerted a strangle-hold on saccharide biochemistry and glycolysis because chimere #10 (Table 3) shared sequence homology with the mRNA encoding fructokinase. In green leaves, sucrose is the main product of photosynthesis. The sucrose is converted to fructose and glucose by invertases. The resulting fructose is phosphorylated by fructokinase to fructose-6-phosphate, whereas the resulting glucose is phosphorylated by hexokinase to hexose-6-phosphate for entrance into glycolysis. Fructokinase is central in saccharide biochemistry regulating fructose flux in cells and homeostasis [89]. By downregulating the abundance of the mRNAs encoding fructokinase and starch synthase, chimeres nos. 4, 7, 9, and 19 reprogrammed the chemical balance between photosynthate accumulation, saccharide metabolism, and glycolysis with consequent decrease of grain yield [19].
Storage protein accumulation: The GDH chemical pathways control the abundance of the mRNA encoding the globulin (vicilin), the main storage protein for which cowpea is globally acclaimed as the source of affordable dietary plant protein. When the yield of protein content is low as in unfertilized control cowpea, it suggested that chimere # 5 (Table 3) did partially degrade some of the mRNA encoding the vicilin [2]. Therefore, GDH through chigramming of chimerem #5 maintained a chemical equilibrium between the plants’ exterior environment and the interior biochemical, metabolic, physiological environment.
Drought resistance: Cowpeas are hardy plants being drought resistant and able to thrive under the inversion by fungi and insects. The mRNAs encoding the proteins: dehydrin, delta-1-pyrroline-5-carboxylase synthase, and drought inducible protein that protect cowpeas from dehydration are among the substrates of chimeres nos. 2, 10, 14, 17 (Table 3). Drought is the most debilitating environmental stress factor that decreases crop growth and harvest yield. When cowpeas were treated with adverse mineral fertilizers, their GDHs chigrammed one or more of the chimeres nos. 2, 10, 14, 17 (Table 3) that incompletely degraded the mRNAs encoding the drought protective enzymes, resulting to the 50% decreases in dry seed yields [1]. Cowpea machinery for resistance to stress extends to the destruction of the mRNA encoding triacylglycerol lipase. Cowpea chimere #16 shared sequence homology with the mRNA encoding triacylglycerol lipase (Table 3). While cowpea does not produce a lot of triglycerides, their accumulation provides a mechanism by which the crop copes with abiotic stress. Different types of abiotic stress induce lipid remodeling through the action of lipases, which results in various alterations in membrane lipid composition. This response induces the formation of toxic lipid intermediates that cause membrane damage or cell death. However, triacylglycerols under stress conditions function as a means of sequestering the toxic lipid intermediates. Moreover, the lipid droplets in which triacylglycerol is enclosed also function as a subcellular factory to provide binding sites and substrates for the biosynthesis of bioactive compounds that protect against insects and fungi [90].
Biological Nitrogen Fixation: GDH isoenzymes chigrammed chimeres that shared sequence homologies with mRNAs encoding key enzymes (isoflavone synthase, apyrase, extensin, ferric leghemoglobin reductase, and lectin) in the rhizobium-cowpea nodulation machinery. Fixing atmospheric nitrogen and converting it to organic nitrogen is a special attribute of leguminous plants, enabling them to thrive on infertile soils. Treatment of cowpea with inappropriate mineral nutrients induced GDH to chigramm one or more of the chimere nos. 5, 8, 9, 10, 11, 12, 15, and 17 (Table 3) that are homologous to the mRNAs encoding the cowpea-rhizobium specific enzymes, with resultant 50% decreases in total amino acid contents [2]. Therefore, GDH through chimmerization of chimeres maintains a chemical equilibrium between the plants’ exterior environment and the interior biochemical, metabolic, and physiological environment.
Lignocellulose Cell Wall: GDH isoenzymes chigrammed chimere #5, (Table 3) that shared sequence homology with the mRNAs encoding the peroxidases. Peroxidases participate in cell wall stiffening reactions by synthesizing lignin [91; 92], a complex biomaterial whose carbon content (soil organic carbon) is associated with the improvement of the aggregation, chemical and agricultural properties of the soil. This is another mechanism by which cowpea as cover crop improves soil chemistry. When cowpea was treated with inappropriate fertilizer, the soil organic carbon content decreased five-fold suggesting that the GDH isoenzymes chimmerized chimere #5 (Table 3) that destroyed the mRNA encoding the peroxidases [93]. Therefore GDH, through chimmerization reprogrammed the mRNA abundance and the chemical equilibrium between the plants’ exterior environment and the interior biochemical, metabolic, and physiological environment, with consequent decrease in grain yield.
Purine and Pyrimidine Nucleotide Biosynthesis: Cowpea GDH isoenzymes repeatedly chimmerized numerous chimeres (Table 3: nos. 1, 2, 5, 8, 9, and 19) that were homologous to the mRNAs encoding the enzymes: phosphoribosyl pyrophosphate amidotransferase, formylglycinamide ribonucleotide amidotransferase, glycinamide ribonucleotide synthase, aminoimidazolecarboximide ribonucleotide transformylase/inosine monophosphate cyclohydrolase, amidoimidazole ribonucleotide carboxylase of purine and pyrimidine nucleotides, histidine, tryptophan, NADP, FAD, NAD, cytokinin, and purine alkaloid biosynthesis. Biosynthesis of purine nucleotides, xanthosine monophosphate, AMP, and GMP require a lot of metabolic intermediates. AMP and GMP are the building blocks of DNA and RNA; and in addition, AMP is the precursor for the cytokinin group of plant growth regulators and a few important coenzymes. GTP and ATP participate in the energy metabolism of the cell. Although there are a few routes that can generate the purine bases from IMP in legume nodules, the preferred route is through IMP dehydrogenase. Both xanthosine and xanthine serve as precursors for the purine alkaloids (theobromine and caffeine) and their further oxidation yields the ureides, allantoin and allantoic acid [78] all of which exert further metabolic demand on cowpeas especially when it is cultivated on infertile soils. These extensive metabolite demands [70] of purine, pyrimidine pathways may explain why the GDH chimmerization steps-in to minimize the wastage of the limited resources of cowpea in the synthesis of DNA, RNA, and cofactors that the crop may not need for its survival during its short growing season in the arid Sahel of sub-Sahara. Therefore, wild-type cowpeas in the sub-Sahara grow slowly, mature abruptly, and the grain yield is very low [88; 94]. Wherefore GDH, through chimmerization reprogrammed the mRNA abundance and the chemical equilibrium between the plants’ exterior environment and the interior biochemical, metabolic, and physiological environment, with consequent decrease in grain yield.
Amino Acid Biosynthesis: The water-tight control of cowpea physio-chemical pathways by environmental conditions and the GDH chimmerization extend to the biosynthesis of amino acids by phosphoenol-pyruvate carboxylase (PEPCase) whose mRNA shared sequence homology with chimere #16 (Table 3). PEPCase recycles CO2 released during photorespiration thus minimizing carbon losses and enhancing carbon economy in higher plants [95]. Pyruvate kinase could convert phosphoenolpyruvate to pyruvate which is the starting intermediate for the biosynthesis of valine, leucine, and alanine. Oxaloacetate is the starting intermediate in the biosynthesis of isoleucine, threonine, lysine, and methionine [86]. Because the relative concentrations of phosphoenolpyruvate and oxaloacetate depend on PEPCase activity, the abundance of the mRNA encoding the enzyme is important in the molecular integration of amino acid biosynthesis. Therefore, chimere #16 functions as a gigantic traffic light, controlling at the molecular level, the biosynthesis and flux of all the essential amino acids (isoleucine, threonine, lysine, methionine, phenylalanine, tryptophane, valine, leucine) in cowpea as in peanut also [86]. Wherefore, by downregulating the mRNA encoding PEPCase, chimere #16 reprogrammed amino acid biosynthesis and consequently decreased the control cowpea dry grain yield.
Phenylpropanoid Biochemical Pathway: Cowpea GDH pathway extends to phenylpropanoid biochemical pathways. Chimere #12 (Table 3) shared sequence homology with the mRNAs encoding 4-coumarate: CoA ligase family that catalyze the activation of 4-coumarate and a few related substrates to the respective CoA esters and thus channels the product phenylalanine into the general phenylpropanoid biochemistry. These phenylpropanoid branch pathways generates various classes of natural products [86; 96; 97] with important functions in plant development and environmental interactions, including lignin for structural support, flavones and flavonols for UV protection, anthocyanins, isoflavones for growth and seed maturation, chalcones and aurones as pigments for the attraction of pollinators and seed distributors, and furanocoumarins as phytoalexins for pest/pathogen defense [98]. Food crop phenylpropanoids are important natural products for their possible ability to inhibit extracellular β-amyloid accumulation in Alzheimer’s disease [99]. By the absence of the mRNAs encoding the enzymes of the phenylpropanoid pathway, the control cowpea was unable to attract pollination insects with consequent decrease in grain development.
The regulation of cowpea phenylpropanoid pathway by GDH-chigramming started at the phenylalanine ammonia lyase (PAL) entry point because chimere nos. 1, 2, 4, 5, 10, 18, and 19 (Table 3) that shared sequence homology with the mRNA encoding PAL were repeatedly produced. This repeated production of those chimeres assures that at least one of them will downregulate the phenylpropanoid pathway no matter how variable the soil mineral concentration and composition are. Many natural products including phenolic compounds, organic acids, glycosides, antioxidants, tannins, sweeteners etc are synthesized via the phenylpropanoid pathway. Most of the natural products are protective to cowpea, but a few (glycosides, and antinutrients) are toxic, causing immunomodulatory effects [100], and the flavonoid glycosides inhibit low density lipoprotein (LDL) oxidation [101] when raw cowpea is consumed. Therefore, the GDH chemical pathways are extensive in cowpea, the chimerems being homologous to the mRNAs encoding the regulatory enzymes in the phenylpropanoid biochemical pathways.
Pest resistance: Many cowpea breeding programs [88; 102] have produced cultivars that are pest and drought resistant which mature early thereby potentially contributing to all-season food availability and food security. But the dry grain yields of the genetically improved lines remain very low in farmers’ plots especially in sub-Saharan Africa [88; 94]. Cowpea chimeres (Table 3) suggest that relieving the stranglehold exerted on the lignocellulosic, photosynthetic, amino acid, nodulation, saccharide, storage protein, purine/pyrimidine etc metabolic/physiological pathways might permit the dry grain harvest and nutritious yield to increase, double, and even to be maximized without cultivating more land area. The stoichiometric mineral mixes [19] have demonstrated their abilities to change the GDH chimmerization.
9.0. The Analogy that emerged from the reprogramming of total RNA abundance and of biological processes by chimerenomic RNA enzyme is that the control cowpea growing on marginal soil could be likened to a resource-poor individual living on a nutrient deficient diet of fruits, vegetables, nuts, grasshoppers etc raised on the marginal soil of his garden. He is lean, and his scaly skin is dehydrated with no reserve proteins and saccharides to power his long-term survival in the environment; but his chimerenomic RNA enzyme is active degrading superfluous mRNA, rRNA, transfer RNA, short RNAs etc and preventing the wastage of his little biochemical energy in the synthesis of protein enzymes and metabolites that his body does not need for survival. The chimerenomic RNA enzymes of the resource-poor person will also degrade mRNAs that encode disorder-related protein enzyme-mediated diseases, like as in the control cowpea (Table 3), that would have been expressed were the individual very well nourished. Therefore, resources-poor individuals on the slippery slope of malnourishment are akin to the wild-type cowpeas in the sub-Sahara Sahel, growing slowly, maturing abruptly, and with low body mass; but their chimerenomic RNA enzymes reprogram their total RNA abundance and biological processes to suppress health disorders, and diseases conditions, and to enhance their cooperate survival in the resources-poor environmental condition. In this way, chimerenomic chemistry promises to unlock novel translational and transformational medical sciences for the prevention, management, and therapy of human health disorders, especially those that are caused by physicochemical changes of the environment.
10.0. Energy Conversions in Biology. GDH chigramming and chimmerization are interrelated chemical reactions of the hexameric isoenzymes, each subunit polypeptide possessing its individual pI value. Thus, each hexameric isoenzyme exists in its special homeostatic electromagnetic environment as it chimmerizes chimerenomic RNA. There is a very wide spread of the pI values (3.5 to 9.5) which confers on the Schiff base complexes an unlimited activity to chimmerize chimerenomic RNA of equally unlimited nucleotide sequence variability; thus, explaining the ability of chimerenomic RNA to degrade entire transcriptome (total RNA) of an organism [16]. In addition to the complexity of the GDH Schiff base pI values, there are other variable factors in the chimmerization process. The variable factors that needed to be optimized include the concentrations of α-ketoglutarate, glutamate, NADH, CaCl2, the ribo-NTPs, and the pH value of the reaction buffer solution [15; 36]. The complexity of NADH-GDH is indeed phenomenal both in its Schiff base dependent chemical mechanisms and furthermore in the 3-D conformations of its subunits in the hexameric isoenzymes [2]. Using crystallographic X-ray diffraction to study GDH allostery, Peterson and Smith [3] observed that the binding of NADH kept the GDH catalytic cleft in a closed confirmation, but binding of ADP behind the NAD+-specific binding domain kept the catalytic cleft open. Binding of glutamate to the NAD+-specific domain induced a large conformational change that closed the cleft between the two domains. Similarly, Bera et al. [4], using cryo-electron microscopy and molecular dynamic simulation to study GDH allostery reported that the binding of NADH triggered anticlockwise conformational rearrangements that enhanced the binding of the inhibitor GTP with the consequent inhibition of the deamination activity. Studies on the allostery confirmed that GDH from higher organisms is a dimer of trimers stacked on top of each other with the crystal lattice of the hexameric GDH isoenzymes having front and back conformations, demonstrating that allosteric regulation plays a crucial role during chigramming.
These conformational changes during chigramming and chimmerization reactions illuminate the dynamic motions involved in the conversion of the energy changes in the physicochemical properties of the environment to another energy dataset, the nucleotide sequences of chimerenomic RNA enzyme. The conversion of the energy dataset stored in total RNA to another energy dataset stored in the amino acid sequences of protein enzyme; and the conversion of the electromagnetic solar energy by the photosynthesis complex to the energy dataset of carbohydrates are of the same biological significance as the conversion of the physicochemical energy of the environment to the energy dataset of the nucleotide sequences of chimerenomic RNA enzyme. The chigramming and chimmerization processes stripped-off from the chimerenomic RNA enzyme the biological constraints imposed on total RNA sequences by genetic code. With its electromagnetic energy, chimerenomic RNA enzyme degrades total RNA readily based on electromagnetic repulsion forces between homologous sequence matches of total RNA and chimerenomic RNA, the more thermally stable of the two kinds of RNA. This electromagnetic superiority makes chimerenomic RNA enzyme a veritable therapeutic tool for cleaning-out any hitherto inexplicable human health disorders that had been managed/prevented/treated without success by focusing on genetic code-based approaches. Environment-wide reprogramming of total RNA abundance by chimerenomic RNA enzyme is the biological check-and-balance by which cells, tissues, higher organisms maintain differential states of energetic equilibria for their short- and long-term survival and could be the innovative translational bridge for linking genetic approaches to chimerenomic therapies for the improved prevention, management, primary care, and clinical treatment of human disease disorders.
11.0. Conclusion. It is predicted by chimerenomics as deduced from the research results and outcomes on higher plants, that the removal of the structural constraints imposed on the sciences of medicine by genetic code could unleash a transformational new medicine, the chimerenomic medicine that would command the chimerenomic RNA enzyme specificities to degrade sick total RNAs, the root causes of human health disorders/disease conditions and prevent them from being translated to corresponding sick protein enzymes.
Appendix:
New Terminologies: Chimerenomic glossary for the new terminologies in life sciences.
a). Clinical chimerenomics: The application of chimerenomics to clinical studies.
b). Chimerenomic Medicine: This is the application of chimerenomics to primary care in the prevention and treatment of human disorders, diseases and wellness conditions in humans.
c). Chimerenomic Chemistry
d). Chimerenomic Physiology
e). Molecular Chimerenomics
f). Chimerenomic Biology
g). Chimerenomic Pharmacology etc.
[1] Osuji GO, Brown TK, South SM. (2008). Discovery of the RNA synthetic activity of glutamate dehydrogenase and its application in drug metabolism research. The Open Drug Metabolism Journal 2, 1-13.
[2] Osuji GO, Madu WC (2015). Glutamate dehydrogenase. In: D’Mello JPF Edition: Amino acids in higher plants. CABI Publishers Wallingford, UK; Boston, USA. pp. 1-29.
[3] Peterson EP, Smith TJ (1999). The structure of bovine glutamate dehydrogenase provides insights into the mechanism of allostery. Structure, 7: 769-782.
[4] Bera S, Rashid M, Medvinsky AB, Sun G, Li B, Acquisti C et al. (2020). Allosteric regulation of glutamate dehydrogenase deamination activity. Scientific Reports 10: 16523
[5] Osuji GO, Brown TK, South, SM. (2009). Nucleotide-dependent reprogramming of mRNAs encoding acetyl coenzyme A carboxylase and lipoxygenase in relation to the fat contents of peanut. Journal of Botany. Vol 2009, article ID 278324 doi: 10.1155/2009/278324.
[6] Osuji GO, Braithwaite C, Pointer R, Reyes J. (1999). Pesticide inactivation of peanut glutamate dehydrogenase: Biochemical basis of the enzyme’s isomerization. J. Agric. Food Chem. 47, 3345-3351.
[7] Osuji GO, Mangaroo AS, Roberts PS. (2001). In vitro isomerization of glutamate dehydrogenase in relation to phytosequestration of lead. SAAS Bull. Biochem. Biotechnol. 14, 60-72.
[8] Osuji GO, Madu WC, Braithwaite C, Beyene A, Roberts PS, Bulgin A, Wright V (2003/4). Nucleotide dependent isomerization of glutamate dehydrogenase in relation to total RNA contents of peanut. Biologia Plantarum 47: 195-202.
[9] Osuji GO, Brown TK, South SM, Duncan JC, Johnson D, Hyllam S. (2012). Molecular adaptation of peanut metabolic pathways to wide variation of mineral ion composition and concentration. American J. Plant Sci. 3: 33-50.
[10] Osuji GO, Braithwaite C (1999). Signaling by glutamate dehydrogenase in response to pesticide treatment and nitrogen fertilization of peanut (Arachis hypogaea L.). J. Agric. Food Chemistry 47: 3332-3344.
[11]. Osuji GO, Brown T. (2007). Role of the RNAs synthesized by glutamate dehydrogenase in the coordinate regulation of metabolic processes. The Icfai J. Biotechnology 1:37-48
[12]. Osuji GO, Johnson PM (2018). Structural properties of the RNA synthesized by glutamate dehydrogenase for the degradation of total RNA. Advances in Enzyme Research 6: 29-52.
[13] Osuji GO, Madu WC (1995). Ammonium ion-dependent isomerization of glutamate dehydrogenase in relation to glutamate synthesis in maize. Phytochemistry 39, 495-503.
[14] Osuji GO, Madu WC (1997). Regulation of sweetpotato growth and differentiation by glutamate dehydrogenase. Can. J. Botany 75: 1070-1078.
[15] Osuji GO, Braithwaite C, Fordjour K, Madu WC, Beyene A, Roberts PS, Wright V. (2003). Purification of glutamate dehydrogenase isoenzymes and characterization of their substrate specificities. Preparative Biochemistry and Biotechnology. 33, 13-28.
[16]. Osuji GO, Madu WC, Johnson PM (2019). Total RNA degradation in vitro and in vivo by glutamate dehydrogenase-synthesized RNA enzyme: Biotechnological applications. Advances in Bioscience and Biotechnology 10: 59-85.
[17] Houseley J, Tollervey D (2009). The many pathways of RNA degradation. Cell 136: 763-776. https://doi.org/10.1016/j.cell.2009.01.019.
[18] Osuji GO, Johnson PM, Madu WC (2021). Electrophoretic purification and characterization of human NADH-glutamate dehydrogenase redox cycle isoenzymes synthesizing nongenetic code-based RNA enzyme. Advances in Enzyme Research 9: 19-35.
[19]. Osuji GO, Johnson PM, Madu WC (2021). Optimization of cowpea dry grain yield through the stimulation of RNA synthetic activity of NADH-glutamate dehydrogenase. American J. Plant Sciences12: No. 01 Article ID: 106854.
[20] Kim N, Kinghorn AD (2002) Highly Sweet Compounds of Plant Origin. Archives Pharmacy Research, 25, 725- 746. http://dx.doi.org/10.1007/BF02976987.
[21] Husain A (1991) Economic Aspects of Exploitations of Medicinal Plants. In: Akerele, O.V. and Heywood, S.H., Eds., Conservation of Medicinal Plants, Cambridge University Press, Cambridge. http://dx.doi.org/10.1017/CBO9780511753312.009
[22] Kinghorn AD, Pan L, Fletcher N, Chai H (2011) The Relevance of Higher Plants in Lead Compound Discovery Programs. Journal Natural Products, 74, 1536-1555. http://dx.doi.org/10.1021/np200391c
[23] Lopez MA, Stashenko EE, Fuentes JL (2011) Chemical Composition and Antigenotoxic Properties of Lippia alba Essential Oils. Genetics Molecular Biology, 34, 479-488. http://dx.doi.org/10.1590/S1415-47572011005000030
[24] De Oliveira PF, Machado RAF, Bolzan A, Barth D (2012) Supercritical Fluid Extraction of Hernandulcin from Lippia dulcis Trev. The Journal of Supercritical Fluids, 63, 161-168. http://dx.doi.org/10.1016/j.supflu.2011.12.003
[26] Attia, M., Kim, S. and Ro, D. (2012) Molecular Cloning and Characterization of (+)-epi-α-Bisabolol Synthase, Catalyzing the First Step in the Biosynthesis of the Natural Sweetener, Hernandulcin, in Lippia dulcis. Archives Biochemistry Biophysics, 527, 37-44. http://dx.doi.org/10.1016/j.abb.2012.07.010.
[27] Takahashi, S., Yeo, Y., Greenhagen, B.T., McMullin, T., Song, L., Maurina-Brunker, J., Rosson, R., Noel, J.P. and Chappell, J. (2007) Metabolic Engineering of Sesquiterpene Metabolism in Yeast. Biotechnology Bioengineering, 97, 170-181. http://dx.doi.org/10.1002/bit.21216
[28] Kinghorn, A.D., Chin, Y., Pan, L. and Jia, Z. (2010) Comprehensive Natural Products Chemistry II: Chemistry and Biology. In: Mander, L., Liu, H. and Verpoorte, R., Eds., Development and Modification of Bioactivity, Elsevier, Oxford, Vol. 3, 269-315.
[29] Degenhardt, J., Kollner, T.G. and Gershenzon, J. (2009) Monoterpene and Sesquiterpene Synthases and Origin of Terpene Skeletal Diversity in Plants. Phytochemistry, 70: 1621-1637. http://dx.doi.org/10.1016/j.phytochem.2009.07.030
[30] Yeo, Y., Nybo, S.E., Chittiboyina, A.G., Weerasooriya, A.D., Wang, Y., Gongora-Castillo, E., et al. (2013) Functional Identification of Valerena-1,10-Diene Synthase, Terpene Synthase Catalyzing a Unique Chemical Cascade in the Biosynthesis of Biologically Active Sesquiterpenes in Valeriana officinalis. The Journal of Biological Chemistry, 288, 3163-3173. http://dx.doi.org/10.1074/jbc.M112.415836
[31] Osuji GO, Brown TK, South SM (2010). Optimized fat and cellulosic biomass accumulation in peanut through biotechnology. International Journal of Biotechnology and Biochemistry. 6: 455-476.
[32] Osuji GO, Brown TK, South SM, Duncan C. Johnson D, Hyllam S (2012a). Molecular Adaptation of Peanut Metabolism to Wide Variations of Mineral Ion Concentration and Combination. American Journal Plant Sciences, 3, 33-50. http://dx.doi.org/10.4236/ajps.2012.31003
[33] Osuji, G.O., Brown, T.K., South, S.M., Johnson, D. and Hylam, S. (2012b) Molecular Modeling of Metabolism for Allergen-Free Low Linoleic Acid Peanuts. Applied Biochemistry and Biotechnology, 168, 805-823. http://dx.doi.org/10.1007/s12010-012-9821-6
[34]. Osuji GO., Brown T.K., South S.M., Duncan J.C., Johnson D. (2011). Doubling of crop yield through permutation of metabolic pathways. Advances Bioscience Biotechnology 2: 364-379. http://dx.doi.org/10.4236/abb.2011.25054
[35] Kinghorn AD, Soejarto DD (2002) Discovery of Terpenoid and Phenolic Sweeteners from Plants. Pure and Applied Chemistry, 74, 1169-1179. http://dx.doi.org/10.1351/pac200274071169
[36] Osuji GO, Konan K, M’Mbijjewe G (2004). RNA synthetic activity of glutamate dehydrogenase. Appl. Biochem. Biotechnol., 2004, 119, 209-228.
[37] Osuji GO, Weerasooriya A, Ampim PAY, Carson L, Johnson P et al. (2015). Molecular Regulation of the metabolic pathways of the medicinal plants: Phyla dulcis. American J. Plant Sciences 6: 1717-1726.
[38] Clifton S, Fauron C, Gibson M, Minx P, Newton K, Rugen M, Spieth J, Sun H (2004). Sequence and comparative analysis of the maize NB mitochondrial genome. Plant Physiology. 136: 3486-3503.
[39] Schöttler MA, Tóth SZ, Boulouis A, Kahlau S (2015). Photosynthetic complex stoichiometry dynamics in higher plants: Biogenesis, function, and turnover of ATP synthase and the cytochrome b6f complex. J. Experimental Botany. 66, 2373–2400. Doi:10.1093/jxb/eru4,
[40] Ortiz de Montellano PR (2005). Cytochrome P450: Structure, Mechanism, and Biochemistry, 3rd ed.; Kluwer Academic/Plenum Press: New York, 2005.
[41] Raucy JL, Allen SW (2001) Recent advances in P450 research. Pharmacogenom. J., 2001, 1 (3), 178-186.
[42] Xu C, Li CY, Kong AN (2005). Induction of phase I, II and III drug metabolism/transport by xenobiotics. Arch. Pharm. Res 28: 249-268.
[43] Zimmermann H (2000). Extracellular metabolism of ATP and other nucleotides. Naunyn-Schmiedeberg’s Arch. Pharmacol. 362: 299-309.
[44] Elfarra AA (2005) In Drug metabolism and transport; Lesh, L.H. Ed.; Humana Press Inc.: Totowa, NJ, pp. 1-18.
[45] Regnier, M.; Lee, D.M.; Homsher, E. ATP analogs and muscle contraction: Mechanics and kinetics of nucleoside triphosphate binding and hydrolysis. Biophys. J., 1998, 74, 3044-3058
[46] Weinsein, J.N.; Pommier, P. Connecting genes, drugs and diseases. Nat. Biotechnol., 2006, 24 (11), 1365-1366.
[47] Park K, Kitteringham NR, Kenny JR, Pirmohamed M (2001). Drug metabolism and drug toxicity. Inflammopharmacology. 9 (1, 2): 183-199.
[48] Hu G, Modrek B, Stensland HMFR, Saarela J, Pajukanta P, Kustanovich V, Peltonen P, Nelson SF, Lee C (2002). Efficient discovery of single-nucleotide polymorphisms in coding regions of human genes. Pharcogenom. J. 2: 236-242.
[49] Ando K, Homa M. Chiba S, Tahara S, Mizutani J (1988). Glutathione transferase from Mucor javanicus. Agric. Biol. Chem. 52, 135-139.
[50] Houston DH (1976). In Bound and Conjugated Pesticide Residues; Kaufman, D.D.; Still, G.G.; Paulson, G.D.; Bandal, S.K., Ed.; American Chemical Society, Washington, D.C. pp. 103-131
[51] McGonigle B, Keeler SJ. Lau SM, Koeppe K, O’Keefe DP (2000). A genomics approach to the comprehensive analysis of the glutathione S-transferase gene family in soybean and maize. Plant Physiol. 124 (3), 1105-1120.
[52] Morgenstern R, Depierre JW, Ernster L (1979). Activation of microsomal glutathione S-transferase activity by sulfhydryl reagents. Biochem. Biophys. Res. Commun. 87, 657-663.
[53] Ates NA, Tursen U, Tamer L (2004). Glutathione S-transferase polymorphisms in patients with drug eruption. Arch. Dermatol. Res. 295, 429-433.
[54] Cammaerts D, Jacobs M (1985). A study of the role of glutamate dehydrogenase in nitrogen metabolism of Arabidopsis thaliana. Planta 163: 517-526.
[55] Chandrasekhar K, Malath R (2003). Non-Watson Crick base pairs might stabilize RNA structural motifs in ribosomes – A comparative study of Group-1 intron structures. Journal of Bioscience 28: 547-555.
[56] Ifuku K, Endo T, Shikanai T, Aro E (2011). Structure of the chloroplast NADH dehydrogenase-like complex: Nomenclature for nuclear-encoded subunits. Plant Cell Physiol. 52: 1560–1568 doi:10.1093/pcp/pcr098
[58] Hove-Jensen B, Kasper R, Andersen KR, Kilstrup M, Martinussen J, Switzer RL, Willemoësd M (2017). Phosphoribosyl Diphosphate (PRPP): biosynthesis, enzymology, utilization, and metabolic significance. Microbiol Mol Biol Rev 81:e00040-16. https://doi.org/10.1128/ MMBR.00040-16. Accessed April 26, 2020.
[59] Hyun MW, Yun YH, Kim JY, Kim SH (2011). Fungal and plant phenylalanine ammonia-lyase. Mycobiology. 39: 257–265. doi:10.5941/MYCO.2011.39.4.257.
[60] Zhang Y, Morar M, Ealick SE (2008). Structural biology of the purine biosynthetic pathway. Cell Mol Life Sci. 65: 3699–3724. doi:10.1007/s00018-008-8295-8.
[61] Juszczuk IM, Rychter AM (2003). Alternative oxidase in higher plants. Acta Biochimica Polonica. 50: 1257-1271.
[62] Ismail AM, Hall AE, Close TJ (1999). Allelic variation of a dehydrin gene co-segregates with chilling tolerance during seedling emergence. Proc. Natl. Acad. Sci. USA 96: 13566-13570.
[63] Blamey FPC, Wehr JB, Wang P, Menzies NW, Kopittke PM (2014). Kinetics and mechanisms of cowpea root adaptation to changes in solution calcium. Plant and Soil 379: 301-314.
[64] Fujii S, Kobayashi K, Nagata N, Masuda T, Wada H (2018). Digalactosyldiacylglycerol is essential for oganization of the membrane structure in etioplasts. Plant Physiology 177: 1487-1497. plantphysiol.org/cgi/doi/10.1104/pp.18.00227.
[65] Endo K, Kobayashi K, Wada H (2016). Sulfoquinovosyldiacylglycerol has an essential role in thermosynechococcus elongatus BP-1 under phosphate deficient conditions. Plant Cell Physiol. 57: 2461–2471. doi:10.1093/pcp/pcw159.
, Glutathione Metabolism and Its Function in Higher Plants Adapting to Stress. In: Antioxidants and Antioxidant Enzymes in Higher Plants pp 181-205. Springer, Switzerland AG.
[67] Tetlow IJ, Morell MK, Emes MJ (2004). Recent developments in understanding the regulation of starch metabolism in higher plants. J. Experimental Botany. 55: 2131–2145. DOI: 10.1093/jxb/erh248.
[68] Curtis TY, Bo V, Tucker A, Halford NG (2018). Construction of a network describing asparagine metabolism in plants and its application to the identification of genes affecting asparagine metabolism in wheat under drought and nutritional stress. Food Energy Security 7(1): e00126. Doi:10.1002/fes3.126
[70] Boldt R, Zrenner R (2003). Purine pyrimidine biosynthesis in higher plants. Physiologia Plantarum. 117:297-304. DOI:10.1034/j.1399-3054.2003.00030.x.
[74] Amann A, Lezhneva L, Wanner G, Herrmann RG, Meurer J (2004). Accumulation of photosystem1, A member of a novel gene family, is required for accumulation of [4Fe-4S] cluster–containing chloroplast complexes and antenna proteins. Plant Cell 16: 3084–3097. Doi:10.1105/tpc.104.024935.
[75] Simoes I, Faro, C (2004). Structure and function of plant aspartic proteinases. Eur. J. Biochem. 271: 2067–2075. Doi:10.1111/j.1432-1033.2004.04136.x.
[76] Lo S, Munoz-Amatriain M, Boukar O, Herniter I, Cisse N et al. (2018). Identification of QTL controlling domestication related traits in cowpea (Vigna unguiculata L. Walp). Scientific Reports 8: 6261.
[77] Tanaka K, Nguyen TH, Stacey G. (2011). Enzymatic role for soybean ecto-apyrase in nodulation. Plant signaling and Behavior 6: 1034-1036.
[78] Smith PMC, Atkins CA (2002). Purine biosynthesis. Big in cell division, even bigger in nitrogen assimilation. Plant Physiology. 128: 793–802. Doi/10.1104/pp.010912.
[79] Iuchi S, Yamaguchi-Shinozaki K, Urao T, Shinozaki K (1996). Novel drought-inducible genes in the highly drought-tolerant cowpea: Cloning of cDNA and analysis of the expression of the corresponding genes. Plant Cell Physiol. 37: 1073-1080.
[80] Becana M, Klucas RV (1992). Oxidation and reduction of leghemoglobin in root nodules of leguminous plants, Plant Physiol. 98: 1217-1221.
Carbonic Anhydrase and Its Role in Photosynthesis In: Leegood RC, Sharkey TD, von Caemmerer S (Eds), Photosynthesis: Physiology and Metabolism, pp. 353–367. Kluwer Academic Publishers, The Netherlands.
[82] Hu CA, Delauney AJ, Verma DPS (1992). A bifunctional enzyme (delta 1-pyrroline-5-carboxylate synthetase) catalyzes the first two steps in proline biosynthesis in plants. Proc. Natl. Acad. Sci. USA 89: 9354-9358.
[83] Lamport DTA, Kieliszewski MJ, Chen Y, Cannon MC (2011). Role of the extension superfamily in primary cell wall architecture. Plant Physiol. 156: 11-19.
[84] Arsenijevic-Maksimovic I, Broughton WJ, Krouse A (1997). Rhizobia modulate root-hair-specific expression of extension genes. Plant Microbe Interaction 10: 95-101.
[85] Sharon N (2007). Lectins: Carbohydrate-specific reagents and biological recognition molecules. J. Biol. Chem. 282: 2753-2764.
[86] Osuji GO, Duffus E, Johnson P, Woldesenbet S, Weerasooriya A et al. (2015). Enhancement of the essential amino acid composition of food crop proteins through biotechnology. American J. Plant Sciences 6: 3091-3108.
[87] Iuchi S, Kobavashi M, Yamaguchi-Shinozaki K, Shinozaki K (2000). A stress-inducible gene for 9-cis-epoxycarotenoid dioxygenase involved in abscisic acid biosynthesis under water stress in drought-tolerant cowpeas. Plant Physiol. 123: 553562.
[88] IITA Annual Report (1984). International Institute of Tropical Agriculture: Grain Legume Improvement Program pages 64-117.
[89] Yang J, Zhu L, Cui W, Zhang C, Li D et al., (2018). Increased activity of MdFRK2, a high affinity fructokinase, leads to upregulation of sorbitol metabolism and downregulation of sucrose metabolism in apple leaves. Horticulture Research. 5:71. DOI 10.1038/s41438-018-0099-x
[90] Lu J, Xu Y, Wang J, Singer SD, Chen G (2020). The Role of Triacylglycerol in Plant Stress Response. Plants 9: 472; doi:10.3390/plants9040472.
[91] Wight JP, Hons FM, South SM, Osuji GO (2012). Purification of active peroxidase isoenzymes and their responses to nitrogen fertilization and rotation of biomass sorghum. American Journal Plant Sciences 3: 1422-1429.
[92] Wight JP, Hons FM, Osuji GO (2014). Responses of bioenergy sorghum cell wall metabolism to agronomic practices. Advances in Biological Chemistry 4: 67-78.
[93] Osuji GO, Madu WC, Duffus E, Johnson P et al. (2016). Regulated lignin structural units and soil organic carbon contents by cowpea peroxidase. J. Agric. Sci. 8: 12-22.
[94] Bingen RJ, Hall AE, Ndoye M (1988). California cowpea and food policy in Senegal. World Development. 16: 857-865.
[95] Singal HR, Singh R (1986). Purification and properties of phosphoenolpyruvate carboxylase from immature pods of chickpea (Cecer arietium L). Plant Physiology 80: 369-373. http://dx.doi.org/10.1104/pp.80.2.369.
[96] Osuji GO, Gao M, Carson L, Ampim P, Weerasooriya A, Johnson P, Duffus E et al. (2017). Biotechnological induction of shikimate-based antioxidant accumulation in Phyla dulcis. The Natural Products J. 7: 104-111.
[97] Osuji GO, Johnson P, Duffus E, Woldesenbet S, Kirven JM (2017). Horticultural production of ultra-high resveratrol peanut. Agricultural Sciences vol. 08: Article ID:80053, 22 pages. DOI. 10.4236/as.2017.810086.
[98] Hamberger B, Hahlbrock K (2004). The 4-coumarate:CoA ligase gene family in Arabidopsis thaliana comprises one rare, sinapate-activating and three commonly occurring isoenzymes. Proceedings National Academy Science USA. 101: 2209–2214. Doi/10.1073/pnas.0307307101.
[100] Kuete V (2013). 7-Phenylpropanoids and related compounds from the medicinal plants of Africa. In: Kuete V Eds. Medicinal Plants Research in Africa: Pharmacology and Chemistry. pp. 51-260. Elsevier Publisher, New York.
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle