Volume 2 Issue 2

New Treatment for Alzheimer’s Dementia and Parkinson’s Disease Ready for Clinical Trial; The Chimerenomic RNA Enzyme.

Remigius N. Okea † , Godson O. Osuji ‡
Date Received January 31. 2025
Date Accepted February 21. 2025

Abstract

Alzheimer’s dementia and Parkinson’s disease are complex neurodegenerative disorders that have defied efficacious therapies. The root causes of the two disorders, being the malfunctioning of the superfluous/mutated mRNAs, tRNAs, rRNAs, and proteins, call for the deployment of chimerenomic research approach for the development of novel drugs for their prevention and treatment. Therefore, all the redox cycle hexameric isoenzymes of the glutamate dehydrogenase (GDH) of cultured human astrocyte cells were made to synthesize NTinti chimerenomic RNA enzymes, and they produced about 63,000,000 chimerenomic RNA enzymes at cell confluency, and 71,000,000 chimerenomic RNA enzymes at cell post-confluency.  Results of functional chimerenomic bioinformatics search engine using the mRNAs encoding β-secretase, amyloid-β-precursor protein, chain 5 protein of 28 S ribosome, small ribosomal subunit protein uS13, and α-synuclein as queries, and the 63,000,000 chimerenomic RNA enzymes produced by astrocyte cells at confluency and the 71,000,000 chimerenomic RNA enzymes produced at post-confluency as subjects showed that all the dysfunctional mRNAs were engulfed and degraded by the chimerenomic RNA enzymes more completely at confluency than at post-confluency astrocyte cells. These nascent advances in the understanding of the effects of aging on the degradation of the Alzheimer’s and Parkinson’s diseases-related malfunctional mRNAs by chimerenomic RNA enzymes will guide the neurological and pharmacological strategies for the new treatments of the disease conditions. The synthesized agents from this study, especially the chimerenomic RNA enzymes, are ready for clinical trial.

 

† Corresponding author email: admin@aapcr.org American Academy of Primary Care research (AAPCR), San Antonio, Texas.

‡ American Academy of Primary Care research (AAPCR), San Antonio, Texas.

 

1.0. Introduction

 

1.1. Alzheimer’s Disease (AD)

As Alzheimer’s disorder progresses, individuals may face challenges in recognizing loved ones and navigating familiar environments. This gradual decline engenders frustration and helplessness not only for the patient but also for their families, who struggle to cope with the emotional and practical demands of caregiving [1]. Additionally, late-stage Alzheimer’s can severely impair physical functioning, resulting in difficulty with mobility, unable to perform activities of daily living (ADL) and an increased risk of falls. Support systems, including professional aid and community resources, become essential to ensure both the safety and well-being of those affected. The disease progression can be classified into 3 stages: Cognitive Un-impairement (CU), Mild Cognitive Impairement (MCI) and Alzheimers’s Disease (AD) [2, 3, 4]. In the CU stage, individuals may exhibit no apparent clinical symptoms, but there is an underlying pathological process at work. As MCI progresses to AD, the deterioration of cognitive functions becomes evident, with patients beginning to struggle with activities of daily living (ADLs). Importantly, whereas those with MCI maintain their independence and can manage their daily tasks, individuals diagnosed with Alzheimer's disease typically require assistance, marking a significant shift in their capabilities and quality of life [3, 5].

 

1.2. Pathogenesis of Alzheimer's Disease

Despite extensive research efforts since Dr. Alois Alzheimer initial observations in 1906 [5, 6, 7], advancements in understanding and treating Alzheimer's disease remain limited. The persistent focus on combating amyloid beta (Aβ) protein clumps and neurofibrillary tangles (NFTs) [8]; reveals a stark truth: effective interventions have proven elusive. Ongoing studies continue to analyze these pathological markers, highlighting the complexity of the illness. As scientists seek innovative approaches, it becomes increasingly clear that a broader perspective may be needed to unravel the mechanisms of Alzheimer's and develop viable treatments [9].

 

1.3. Current knowledge on Alzheimer's Disease Pathogenesis:

Amyloid pathogenesis is a critical process in the development of neurodegenerative diseases, particularly Alzheimer's disease [10]. It begins with the altered cleavage of amyloid precursor protein (APP), an integral protein located on the plasma membrane of neurons. This abnormal processing is primarily mediated by two key enzymes: β-secretases (BACE1) and γ-secretases [11]. When APP is cleaved by β-secretases, it produces soluble fragments, but the subsequent action of γ-secretases is what leads to the formation of amyloid-beta (Aβ) peptides, specifically Aβ40 and Aβ42. These monomers are crucial because they have a tendency to oligomerize and aggregate, forming insoluble Aβ fibrils that accumulate into senile plaques—a hallmark of Alzheimer's disease. Once formed, Aβ oligomers diffuse into synaptic clefts, where they disrupt synaptic signaling [12]. This interference can lead to impaired communication between neurons, contributing to cognitive decline. As the process continues, Aβ monomers polymerize into insoluble amyloid fibrils, which further aggregate into larger plaques [9, 13, 14, 15, 16].

The presence of these plaques triggers a cascade of neurodegenerative events. One significant outcome is the activation of kinases, which leads to the hyperphosphorylation of the microtubule-associated protein tau (τ). Hyperphosphorylated tau then polymerizes into neurofibrillary tangles (NFTs), another pathological feature of Alzheimer's disease [17].

The aggregation of amyloid plaques and neurofibrillary tangles does not occur in isolation. It is accompanied by the recruitment of microglia, the brain's resident immune cells [18]. These microglia become activated in response to the presence of plaques, leading to a local inflammatory response. While this response is initially protective, chronic activation can contribute to neurotoxicity and exacerbate neuronal damage [13].

Aβ plaques first emerge in specific areas of the brain, notably the basal, temporal, and orbitofrontal neocortex [19, 20]. These regions are crucial for various cognitive functions, including memory, decision-making, and emotional regulation. The early accumulation of plaques in these areas is often linked to the initial cognitive impairments observed in individuals with Alzheimer's disease.

As the disease advances, Aβ plaques begin to spread throughout the neocortex, affecting additional regions such as the hippocampus, amygdala, and diencephalon. The hippocampus is vital for memory formation and retrieval, and its involvement is closely associated with the memory deficits characteristic of Alzheimer's disease [20].

The basal ganglia, which play a role in movement and coordination, also become affected in later stages. The spread of Aβ plaques to these areas can contribute to a range of symptoms, including changes in motor function and behavior [20].

In critical cases of Alzheimer's disease, Aβ plaques can be found throughout the mesencephalon (midbrain), lower brain stem and cerebellar cortex. The involvement of these regions indicates a more widespread neurodegenerative process, which can lead to severe cognitive and physical impairments. The mesencephalon is involved in various functions, including vision, hearing, and motor control, while the cerebellar cortex is essential for coordination and balance [13, 20].

To maintain cellular homeostasis, all cells must continually synthesize new proteins. This process is crucial for various cellular functions, including growth, repair, and response to environmental changes. At the heart of protein synthesis are ribosomes, also known as polyribosomes, which are specialized complexes made up of ribonucleic acids (RNA) and proteins [21].

Ribosomes play a pivotal role in translating messenger RNA (mRNA) into proteins, a process that involves several key components. Among these, ribosomal RNA (rRNA) and transfer RNA (tRNA) are essential. rRNA forms the structural and functional core of the ribosome, facilitating the binding of mRNA and tRNA during translation. Meanwhile, tRNA serves as the adaptor molecule that brings the appropriate amino acids to the ribosome, matching them to the codons on the mRNA strand [21, 22].

The intricate interplay between these molecules ensures that proteins are synthesized accurately and efficiently, allowing cells to adapt and thrive in their environments. By continuously producing new proteins, cells can maintain their functions and respond to the dynamic nature of their surroundings, ultimately supporting the overall homeostasis of the organism.

Impairments in ribosome function have been increasingly recognized as a significant factor in the pathology of AD [22]. Research indicates that these dysfunctions are associated with a decreased rate and capacity for protein synthesis, which is critical for maintaining cellular health and function. Specifically, alterations in the levels of ribosomal RNA (rRNA) and transfer RNA (tRNA) have been observed, alongside an increase in RNA oxidation.

These changes suggest that disruptions in protein synthesis may contribute to the onset and progression of AD. Among the various components of the ribosome, the malfunction of 28S ribosomes appears to play a particularly significant role. [23] The 28S rRNA is a crucial part of the ribosomal structure, and its impairment can lead to a cascade of effects that compromise the cell's ability to produce essential proteins [20, 23].

As protein synthesis is vital for neuronal function and survival, any decline in this process can have profound implications for brain health. The connection between ribosomal dysfunction and AD highlights the importance of understanding how these molecular changes contribute to the disease's development [23], potentially opening avenues for therapeutic interventions aimed at restoring normal protein synthesis and improving cellular function in affected individuals.

 

1.4. Parkinson’s Disease (PD)

This neurodegenerative disease presents with a clinical hallmark of tremor at rest, muscle rigidity and bradykinesia. As Parkinson's disease progresses, the challenges faced by individuals can become more complex. While bradykinesia creates obstacles in movement, the emergence of cognitive decline often compounds these difficulties. This duality of physical and cognitive impairments not only affects mobility but also hampers the ability to engage socially and complete everyday tasks. Furthermore, mood disorders can exacerbate feelings of isolation, as individuals struggle to cope with their condition [24]. Therefore, a comprehensive approach that addresses both physical symptoms and mental health is crucial for improving the quality of life in those affected by Parkinson's disease.

 

1.5. Pathogenesis of Parkinson's disease:

The loss of dopaminergic neurons in the substantia nigra of the midbrain is indeed a hallmark characteristic of Parkinson’s disease (PD) [24, 25, 26]. Dopaminergic neurons in the substantia nigra play a crucial role in the regulation of movement, coordination, and various cognitive functions. The degeneration of these neurons leads to a significant decrease in dopamine levels [25, 26], which is essential for smooth and controlled muscle movements.

Protein misfolding not only contributes to the distinct characteristics of each disorder but also facilitates cross-talk between different neurodegenerative pathologies. This highlights the potential for shared therapeutic strategies targeting the underlying mechanisms of misfolded proteins. Understanding these interactions is crucial for developing comprehensive treatment approaches for patients suffering from Alzheimer's disease, Parkinson's disease, and related proteinopathies [20, 27]. Lysosomal dysfunction may also be involved in Parkinson’s disease [28].

Recent research has begun to elucidate the interplay between these mechanisms, indicating that mitochondrial dysfunction may exacerbate α-synuclein aggregation, while neuroinflammation can hinder protein clearance [29]. Understanding these interactions is crucial for developing targeted therapeutic strategies. Ongoing studies aim to clarify these relationships and their implications for PD progression and treatment [24, 30, 31].

In Parkinson's disease (PD), disruptions in mRNA processing have been linked to the small ribosomal subunit protein uS13 [31, 32]. These malfunctions can result in flawed protein synthesis, contributing to neurodegeneration. Research suggests that alterations in the translation machinery may play a crucial role in the progression of PD, like in Alzheimer’s disease. Understanding these parallels may offer insights into therapeutic strategies targeting ribosomal function.

Research over the years has consistently implicated secretases, amyloid precursor proteins, and plague deposits in the brain as the hallmark signatures of AD [33]. While the roles of α-synuclein and ribosomes, ribosomal RNA (rRNA), transfer RNA (tRNA), and messenger RNA (mRNA) in the protein synthesis process have been acknowledged, a definitive solution for AD and PD remains elusive.

This unique study aims to address this knowledge gap by applying innovative approaches from Chimerenomic sciences, which integrates first-order principles in nucleic acid chemistry. This cutting-edge field has the potential to modulate and regulate various types of RNA, offering a promising avenue for the development of therapeutic strategies against AD and PD.

Chimerenomic sciences focus on synthesizing and producing a unique RNA enzyme designed to target the underlying mechanisms of AD and PD. By enhancing the regulation of RNA molecules involved in protein synthesis, this approach could specifically degrade malfunctional mRNAs, rRNAs, tRNAs etc and potentially restore normal cellular function and mitigate the detrimental effects of protein misfolding and aggregation.

The implications of this research are profound, as it not only seeks to provide a cure for AD and PD but also paves the way for a deeper understanding of RNA's role in neurodegenerative diseases. By harnessing the power of Chimerenomic sciences, we may be on the brink of a breakthrough that could transform the landscape of Alzheimer's and Parkinson’s treatments and improve the quality of life for millions affected by these devastating conditions.

 

2.0. Materials and Methods

2.1. In Vitro Culture of Human Astrocyte Cells: Human astrocyte progenitor lines were acquired from iX Cell Biotech, and their protocols including thawing and seeding, daily media changes, and cell harvesting procedures were used by Southwest Research Institute to grow the cultures [34]. The experimental phase extended up to Day 11, with monitoring of cellular developments. Notably, cultures were established in duplicate, creating Control A and Control B, both starting from identical numbers of the progenitor cells. Control A was harvested on day 9, exactly at the point of confluence. On the other hand, Control B was harvested on day 11, after 2 days of post-confluence.

 

2.2. Extraction of NADH-Glutamate Dehydrogenase Hexameric Isoenzymes from Human Astrocyte Cells. Free solution isoelectric focusing and PAGE (polyacrylamide gel electrophoretic) concentration of the hexameric isoenzymes were performed as described earlier [34]. The Control A human astrocyte cells (120,000 cells) harvested on day 9 at cell confluency, and the Control B (120,000 cells) harvested on day 11 at post-confluency were applied for the enzyme extraction [34]. The cell pellet was homogenized in 80 mL of 15 mM Tris-HCl buffer solution, pH 7.5, containing 20 µL β-mercaptoethanol, 2 Units of DNase 1, and 1 Unit of RNase A for 1 min at maximum speed. The homogenate was left to stand at room temperature for 30 min for DNA and RNA to be degraded. Protein precipitated by solid (NH4)2SO4 between 20% and 55% saturation of the homogenate was collected by centrifugation (10,000 x g, 30 min, 5˚C). The pellet was resuspended in minimum volume of 15 mM Tris-HCl pH 7.5 buffer solution, and dialyzed in 5 L of 15 mM Tris-HCl buffer solution pH 8.5 with three changes of the buffer solution over a period of 36 h. The dialyzed extract was made up to 50 mL with 10 mM Tris-HCl buffer pH 7.5, and subjected to Rotofor (Bio-Rad, Hercules, CA) free solution isoelectric focusing fractionation. Rotofor fractions were dialyzed in 5 L of 10 mM Tris-HCl buffer solution pH 8.5 also at 5˚C with three changes of the buffer over a period of 36 h to remove the ampholyte and urea.

 Aliquots (250 µL) of the dialyzed Rotofor fractions were subjected to Laemmli SDS 12% polyacrylamide gel electrophoresis (PAGE) (100 V, 14 h, 4˚C) to remove nucleic acids and other proteins. Protean II xi electrophoresis cell (Bio-Rad, Hercules, CA) was used. The electrophoresed gels were washed three times with 0.15 mM Tris base at 5˚C to remove the SDS. One gel was thereafter stained with L-glutamate-NAD+-phenazine methosulfate-tetrazolium blue reagent at room temperature. The GDH hexameric redox cycle isoenzyme distribution pattern was photo documented. The second electrophoresed gel was applied for the elution of the GDH hexameric isoenzymes contained therein. Rotofor purification was repeated two or three times to assure reproducibility of the GDH isoenzyme pattern per experimental astrocyte cultured cells [34].

 

2.3. Whole Gel Elution of the Hexameric Isoenzymes: The stained polyacrylamide gel (PAG) as template was placed under the unstained PAG on a light box to cut out the section of the unstained PAG containing the GDH hexameric isoenzymes as already described [35, 36]. The GDH isoenzymes were electro-eluted from the excised piece of PAG using Bio-Rad mini-whole gel eluter at subzero temperature. The whole-gel purified GDH isoenzymes contained about 4 µg protein per ml. The protein contents were determined using the Folin-phenol reagent, and with bovine serum albumen as standard [37].The eluted GDH hexameric isoenzymes (about 6 mL total volume) were not stored but applied immediately for chimerenomic RNA enzyme synthesis in order to maintain the molar relationships between the GDH hexamers and the biological idiosyncrasy of the astrocyte cells used in the extraction of GDH [38].

 

2.4. Chimerenomic RNA Enzyme Synthesis: The substrate cocktail has already been described [36]; and was prepared by adding the four ribo-NTPs (0.6 mmol each), NH4Cl (100 µmol), α-KG (50 µmol), NADH (0.2 µmol), DNase 1 (1 U), actinomycin D (2 µg), and RNase inhibitor (10 U); the final volume was made up to 1 mL with 0.1 M Tris-HCl buffer solution pH 8.0. The reaction was started by adding 1.0 mL of GDH isoenzyme solution, followed by incubation at 16˚C overnight in the chilled circulating water bath of chimerenomic pump [39]. RNA synthesis was stopped by phenol-chloroform (pH 5.5) extraction of the GDH. RNA was precipitated with ethanol, air-dried briefly, and dissolved in 40 µL of molecular biology quality water, and stored as 5 µL aliquots at -80 0C. RNA synthesis was carried out in duplicate to verify reproducibility of the yields. 

 

2.5. Chimerenomic RNA Sequencing: The RNAs were custom sequenced by CD Genomics, New York, USA.

 

 

3.0. Results and Discussion

 

3.1. Quality of the Cultured Astrocyte Cells at Harvest. The diameter of the astrocyte cells of 15.7 on day 9 at confluency, and 15.8 on day 11 post confluency; cell viability of 97.9% on day 9, and 99.3% on day 11; cell count of 8.71 million on day 9, and 6.79 million on day 11 were evidence that the cell handling protocols and procedure throughout the experimentation [34] agreed with the standards recommended by the American Type Culture Collection [38]. Therefore, the comparative research design that includes a control at cell confluency and a parallel control that extends post confluency are more comprehensive in adducing new results at the molecular level than the statistical triplicating design that lacks any insight into the chemical reactions occurring at the molecular levels.

 

 3.2. GDH Hexameric Isoenzyme Distribution Patterns on Slab of PAG

In the human astrocyte cells, the hexameric GDH isoenzymes numbered about 13 for the Control A at confluency but were up to 18 for the Control B at 2 days post confluency compared with the standard statistical binomial distribution pattern of the 28 isoenzymes that is skewed to the left [34]. Therefore, Control A astrocyte GDH distribution pattern deviated from that of the standard binomial showing that environmental physicochemical changes occurred also in the Control A astrocyte cell culture, but the physicochemical changes that occurred in the Control B at post confluency were more elaborate and challenging to the cells. These visible differences in the GDH isoenzyme distribution patterns are noteworthy because they will resurface again and again to corroborate the differences in the chimerenomic RNA enzyme sequence complexities that the different GDH isoenzyme patterns synthesized. However, it is not the numbers of the hexameric isoenzymes that determine GDH chemical activities, rather it is the yield of the NTinti chimerenomic RNAs they synthesize together with the nucleotide sequence complexities of the chimeres synthesized. The less complicated the chimere RNA sequences are, the less active the GDH hexameric isoenzymes are in the synthesis of complex chimeres (refer to appendix 1 for glossary and terminologies).

            GDH is encoded by two nonallelic genes (GHD 1 and GDH 2) with GDH 1 encoding the more acidic polypeptides (a) and (α), being heterozygous and codominant; and GDH 2 encoding the less acidic polypeptide (β) being homozygous [36]. The binomial distribution of the three types of polypeptides gives rise to the complex system of hexameric isoenzymes. In the human laryngeal epithelial cells, the GDH was readily resolved to 28 hexameric isoenzymes [36]. This is evidence for the tissue specificity of the biological function of the enzyme. The differences of the numbers and distribution patterns of the hexameric isoenzymes show that GDH responds to the cues of growth, development, and aging manifested as the human astrocyte cells transition from confluency to post confluency. As an aim of this experiment was to define the chemical basis of cellular maturity in human health and disease conditions, the involvement of GDH in the morphological change of human astrocyte cells has interjected far-reaching implications on the practice of molecular cell biology. Changes in the numbers of the hexameric isoenzymes of GDH are caused by chemical reaction [34]. It is an exact chemical event as Osuji and Okea unequivocally demonstrated, not by sciences that are beclouded in uncertainties and statistical probabilities because no number of triplicate resets of the cell culture protocols would have altered the GDH fingerprint and patterns [34].

Many human health disorders especially Alzheimer’s and Parkinson’s are inexplicably entangled and concealed in human physiology, nutrition, genetics, pharmacology, neurosciences, genomics, metabolism etc [40, 41]. Illumination of those persisting inexplicable biological phenomena will open new medical interventions for prevention and possibly also transformational therapies for treatment of more human health disorders. In this regard, the most notable nascent science is the synthesis of high molecular weight nongenetic code-based RNA (NTinti) by NADH-glutamate dehydrogenase (GDH; EC 1.4.1.2) hexameric isoenzymes.

GDH is a complex enzyme both in its Schiff base dependent chemical mechanisms and in the 3-D conformations of its subunits in the hexameric isoenzymes [34]. A crystallographic X-ray diffraction study of GDH allostery showed that the binding of NADH kept the GDH catalytic cleft in a closed confirmation, but the binding of ADP behind the NAD+-specific binding domain kept the catalytic cleft open. Binding glutamate to the NAD+-specific domain induced a large conformational change that closed the cleft between the two domains. Similarly, cryo-electron microscopy and molecular dynamic simulation studies on GDH reported that the binding of NADH triggered anticlockwise conformational rearrangements that enhanced the binding of the inhibitor GTP with the consequent inhibition of the deamination activity. Studies on the allostery showed that GDH from higher organisms is a dimer of trimers stacked on top of each other with the crystal lattice of the hexameric GDH isoenzymes having front and back conformations, demonstrating that allosteric regulation plays a crucial role during in vivo catalysis.

The protonated Schiff base intermediate between the GDH and α-ketoglutarate (α-KG) is predisposed to nucleophilic attack by ammonium ion, ribo-nucleoside triphosphates  [40, 41], saccharides, amino acids, phosphate, K+, sulfate, polypeptides, chitosan, toxic substances (including but not limited to phytochemicals, heavy metal ions, psychotic chemical substances, fungicide, herbicides) (GDH-chimmerization) in the cell. In the active site of GDH hexamers, the protonated and the unprotonated Schiff bases of adjacent subunit polypeptides cooperate to catalyze ribo-nucleoside triphosphate (ribo-NTP) polymerization reaction by orientating the 3’ nucleotide residue at the growing end of the RNA, and the incoming ribo-NTP, in juxtaposition to permit nucleotide bond formation to occur [40]. The aggregate GDH hexameric isoenzymes of any tissues have different pI (isoelectric point) values ranging from pI ~4 to 9.5. So, in any environmental conditions, only some of the isoenzymes will be at neutral pI value. Schiff base complex formation is more/less catalyzed by a physicochemical cooperation between the protonated and the unprotonated adjacent hexameric isoenzymes.

When there is physicochemical change in the environmental conditions, the nucleophiles that attack the Schiff base complex are not only ribo-NTPs; they lead to the formation of dead-end complexes that inactivate GDH. The inactivated GDH polypeptides are degraded by proteases. Thus, a new GDH isoenzyme population pattern arises in the cells, tissues, and the whole organism whenever there is a physicochemical change in the environmental conditions as illustrated by the transition from confluency to post-confluency aging processes [34]. The prevalent GDH isoenzymes then spontaneously synthesize a new set of chimerenomic RNA enzyme (NTinti), which immediately degrade and wipe-out pre-existing malfunctioning, mutated, superfluous mRNA, transfer RNAs, rRNAs etc that the cells and tissues no longer need for healthy metabolism and biological programs of survival; and they unleash a new biological order that is in equilibrium with the new environment, for the continued longevity of the organism. The fundamental function of NADH-GDH is therefore to convert the physicochemical environmental changes into the high molecular weight NTinti RNA primary structure. The conversion of the environment-wide changes of cells, tissues, whole organisms to the nucleotide sequences of chimerenomic RNA enzymes is of similar biological importance and consequence as the conversion of the genetic information in total RNA (mRNAs, rRNAs, transfer RNAs) to give the amino acid sequences of proteins. Environmental conditions can now be analyzed and described as specific RNA databases (Chigramming) different from gene bank genomics. This is a novel translational understanding of GDH molecular chemistry that holds the potential for groundbreaking innovations with potential to transform several branches of the sciences, medicine, pharmacology, engineering, economics etc.

 

The inactivated dead-end complexes of GDH have been immunochemically demonstrated  [42]. The identification of GDH dead-end complexes is live evidence that GDH is the enzyme that synthesizes chimerenomic RNAs (chimeres and NTintis), and that GDH-chimmerization and chigramming are studies in chemical reaction mechanisms. This organic chemistry mechanism, being template independent, spontaneously synthesizes giga quantities of chimerenomic RNA enzymes which then degrade homologous total RNA (mRNA, rRNA, transfer RNA) thereby leading to the reprogramming and repositioning of metabolic processes and providing potential therapies for neurodegenerative health disorders Alzheimer's and Parkinson's diseases etc.

 

3.3. Chimerenomic NTinti RNA Sequencies

The chimerenomic RNA enzymes that were synthesized by the GDH hexameric isoenzymes of the Control human astrocyte cells are in the AAPCR Data File numbers 1 to 4 (refer to the appendix for explanation of terminologies).  The chimerenomic RNA that was synthesized by the GDH hexameric isoenzymes of the Control A astrocyte cells at confluency are two NTintis File ID numbers CHCOO1 and CHCOO2 each being about 31,500,000 chimerenomic enzymes, each enzyme being about 150 nucleotides long to give a total of 63,000,000 chimerenomic RNA enzymes.

The chimerenomic RNA enzyme that was synthesized by the GDH hexameric isoenzymes of the Control B astrocyte cells at post confluency are two NTintis File ID numbers CHCOO3 and CHCOO4 each being about 35,500,000 chimerenomic enzymes, each enzyme being about 150 nucleotides long to give a total of 71,000,000 chimerenomic RNA enzymes.

The human brain transcriptome contains about 32,802 transcripts, each being about 2,770 nucleotides long [43]. The above statistics, which now permit a comparison of the size of the human transcriptome with the size of the human Control astrocyte chimerenomic NTinti RNA enzymes shows that the transcriptome is merely about 1% the size of the NTinti RNA enzymes. Herein lies the ability of chimerenomic RNA enzyme activity in vivo to spontaneously degrade all mutated, malfunctional, superfluous total RNA (mRNA, tRNA, rRNA, micro-RNA etc), to reset their abundances, and to reprogram biological processes in the cells, tissues, and whole organism [34, 40]. 

 

3.4.0. AAPCR functional chimerenomic bioinformatics search engine applied to Alzheimer’s and Parkinson’s disorders: The functional chimerenomic bioinformatics search engine was developed also for the analyses of the degradation of superfluous/dysfunctional mRNAs, rRNAs, transfer RNAs etc by chimerenomic NTinti RNA enzymes (File Identification Numbers) and total RNA (mRNA, rRNA, tRNA etc) sequences. The Chimerenomic sciences research approach permitted simultaneous studies on the astrocyte mRNAs encoding many dysfunctional/mutated proteins of the neurodegenerative disease pathways.

3.4.1. mRNAs encoding malfunctional proteins of Alzheimer’s disease pathway: Using the chimerenomic search engine and the AAPCR data file ID numbers CHCOO1, and CHCOO2 as subjects, and  the mRNAs encoding the Alzheimer's disease-related Chain 5 protein in the 28S ribosome, GenBank Sequence identification number: 8QFD_5 [44]; that of the amyloid beta precursor protein: NCBI Reference sequence NM_001385253.1 [22]; that of beta-secretase: GenBank Accession number AF201468 [45]; and that of α-synuclein: Accession number P37840-1 [46] as queries produced mRNA degradation matches with all the 63,340,502 chimerenomic RNA enzymes that were synthesized by the GDH hexameric isoenzymes of the Control A human astrocyte cells at confluency [34].

Using the chimerenomic search engine and the AAPCR data file ID numbers CHCOO3, and CHCOO4 as subjects, and  the mRNAs encoding the Alzheimer's disease-related Chain 5 protein in the 28S ribosome, GenBank Sequence identification number: 8QFD_5 [44]; that of the amyloid beta precursor protein: NCBI Reference sequence NM_001385253.1 [22]; that of beta-secretase: GenBank Accession number AF201468  [45]: that of α-synuclein: Accession number P37840-1 [46] as queries produced mRNA degradation matches with all the 71,068,404 chimerenomic RNA enzymes that were synthesized by the GDH hexameric isoenzymes of the Control B human astrocyte cells at post confluency [34].

These spectacular increases in the numbers of age-related mRNA degradation homologies from confluency to post confluency begin to illuminate as never before, the chemical reactions occurring deep in the molecular levels of Alzheimer’s disorder during the astrocyte aging processes.

 

3.4.2. mRNAs encoding malfunctional proteins of Parkinson’s disease pathway:

Using the chimerenomic search engine and the AAPCR data file ID numbers CHCOO1, and CHCOO2 as subjects, and the mRNA encoding the Parkinson’s disease-related small ribosomal subunit protein uS13, GenBank Sequence ID: NP_072045.1 as query [32] revealed that the malfunctional mRNA was degraded by each of the 63,340,502 chimerenomic RNA enzymes that were synthesized by the GDH hexameric isoenzymes of the Control A human astrocyte cells at confluency.

Using the chimerenomic search engine and the AAPCR data files ID numbers CHCOO3, and CHCOO4 as subjects, and  the malfunctional mRNA  encoding the Parkinson’s disease-related small ribosomal subunit protein uS13, GenBank Sequence ID: NP_072045.1 as query revealed that the malfunctional mRNA was degraded by each of the 71,068,404 chimerenomic RNA enzymes that were synthesized by the GDH hexameric isoenzymes of the Control B human astrocyte cells at post-confluency.

These search engine results mean that post confluency compared with confluency human astrocyte GDH hexameric isoenzymes synthesized 7,727,899 more chimerenomic RNA enzymes with activities that spontaneously degraded more of the malfunctional mRNAs in Alzheimer’s and Parkinson’s disorders thus enhancing the reversals from the disorders. GenBank search engines did not possess the RNA data sets to reveal the mechanisms in molecular chemistry by which chimerenomic RNA enzymes degraded superfluous mRNAs, thereby confirming that chimerenomics is a new science.

 

4.0. Further Discussion

 

4.1. Redefining The Pathogenesis of Alzheimer’s Dementia and Parkinson’s Disease.

The defining characteristic of these diseases is the accumulation of abnormal proteins in the brain, resulting from the malfunction of any or all specific types of genetic code-based RNAs, including mRNA, rRNA, tRNA, and genetic code-based total RNA involved as disease determinants. This leads to series of reactions, including inflammation, oxidative stress, activation of microglia, and ongoing neurodegeneration and cell death. As a result, many of these neurodegenerative disorders are commonly called proteinopathies [20, 27]. In addition, the accumulation of toxic free radicals in the body, as is the case with aging and toxin exposures, [47, 48] may progressively cause distortions in the synthesis of RNAs and lead to production of more dysfunctional RNAs [49].

 

This study has enhanced our understanding of the previously described pathogenesis by exploring the cellular mechanisms that regulate and maintain the stability of genetic code-based total RNAs in the body. It reveals the presence of Chimerenomic RNA—a type of RNA enzyme not based on the genetic code—that all cells produce in response to both internal and external signals to correct and eliminate superfluous genetic code-based total RNAs. In this way, it gets rid of malfunctioning mRNAs, rRNAs, tRNAs, and others before they have the chance to create proteins. As a result, the body ensures that only functional mRNAs, rRNAs, tRNAs, and similar molecules reach their target for protein synthesis. With this understanding, this study provides exciting insights into the role of Chimerenomic RNA enzymes in human astrocytes, particularly in relation to cellular aging and its implications for neurodegenerative diseases like Alzheimer's disease (AD) and Parkinson's disease (PD).

 

Initially, in younger and actively growing astrocyte cultures, these enzymes demonstrated high efficiency, effectively maintaining a tight regulatory gateway. This ensures that only properly functioning genetic code-based RNAs are allowed to proceed to protein synthesis, safeguarding the integrity of cellular functions. However, as the astrocytes age, cell numbers decline, accompanied by a notable decline in the efficiency of the Chimerenomic RNA enzymes synthesized. Aging is associated with accumulation of oxidative oxygen free radicals causing increased oxidative stress [47, 48]. This decline results in an increasing number of malfunctional genetic code-based RNAs escaping the regulatory gateway. Consequently, these aberrant RNAs can reach the protein synthesis machinery, leading to the production of various insoluble proteins. The accumulation of these proteins is a hallmark of neurodegenerative conditions, contributing to the pathology observed in the brains of AD and PD patients.

 

Therefore this research underscores the critical role of Chimerenomic RNA enzymes in maintaining cellular health and highlights how their reduced synthesis may contribute to the onset and progression of neurodegenerative diseases. Further exploration of this mechanism could pave the way for potential therapeutic strategies aimed at enhancing the efficiency of these enzymes to treat neurodegenerative diseases. Chimerenomic RNA enzymes play a crucial role in the repair, modulation, and restoration of genetic code-based RNA within cells and tissues. However, their efficiency can be significantly impacted by several factors, particularly aging. As we age, the internal energy systems of our cells often decline due to accumulation of free radicals [47, 48, 49], this can lead to reduced efficiency in RNA repair mechanisms. This decline can result in the manifestation of subtle errors in mRNA, tRNA, rRNA and others that would have typically been corrected by Chimerenomic RNA enzymes to escaping the regulatory gateway, ultimately reach protein synthesis and affect cellular function. Moreover, environmental factors can exacerbate these issues. Exposure to harmful substances such as tobacco, alcohol, and drugs, as well as poor dietary choices and toxic medications, can lead to cellular damage. These factors can disrupt the integrity of genetic code-based RNAs, making them more susceptible to malfunction. In the absence of efficient Chimerenomic RNA enzymes, the dysregulation of protein synthesis becomes a plausible outcome, further complicating the body’s ability to maintain RNA homeostasis and repair itself.

 

Thus, the efficiency of Chimerenomic RNA enzymes is influenced by age, internal and external environmental factors, that can lead to a cascade of genetic code errors and cellular dysfunction. Understanding these dynamics is essential for developing strategies to enhance RNA repair mechanisms and improve overall cellular health.

This study also revealed a fascinating adaptive response in healthy cells when exposed to noxious signals or substrates. In such situations, these cells rapidly begin to produce Chimerenomic RNA enzymes as a protective mechanism. This response is crucial for preventing alterations in the genetic code-based functional total RNA balance, thereby ensuring cellular survival.

In both ideal and adverse environments, the synthesis of Chimerenomic RNA enzymes plays a vital role in maintaining this balance. By continuously producing these enzymes, cells can effectively counteract the potential disruptions caused by harmful stimuli. This dynamic process highlights the resilience of healthy cells and their ability to adapt to challenging conditions, ultimately safeguarding the integrity of their genetic functional translation and supporting overall cellular health.

Understanding this mechanism not only sheds light on the protective roles of Chimerenomic RNA enzymes but also opens avenues for further research into therapeutic strategies that could enhance cellular resilience in the face of environmental stressors.

 

4.2. Application of these new understanding for the cure of AD and PD

This study successfully synthesized the complete Chimerenomic RNA enzyme from normal, growing human astrocytes, both during their confluence and as they aged. This groundbreaking work provides a comprehensive blueprint for a powerful tool designed to correct superfluous genetic code-based RNAs.

The synthesized NTinti macromolecular Chimerenomic RNA enzymes are astonishingly large, with some containing over 10.5 billion nucleotide bases—making them approximately 3 times larger than the entire human genome that has 3.2 billion base pairs [50, 51], and 100 times larger than the human brain transcriptome [43]. These colossal molecules function like a mop, effectively binding to and eliminating malfunctioning genetic code-based RNAs that are implicated in neurodegenerative diseases such as Alzheimer's Disease (AD) and Parkinson's Disease (PD).

By targeting and removing these dysfunctional RNAs, the Chimerenomic RNA enzymes hold great promise for restoring the balance of genetic information within cells, potentially mitigating the effects of diseases resulting from proteinopathies. This innovative approach not only enhances our understanding of RNA dynamics in critical brain cells but also paves the way for future therapeutic interventions aimed at curing AD and PD. The Chimerenomic RNA enzymes drugs are ready for clinical trial.

In this study, four distinct Chimerenomic RNA enzymes were synthesized, designated as CHC001, CHC002, CHC003, and CHC004. Notably, CHC003 and CHC004 demonstrated complete homology with the malfunctioning mRNA associated with the 28S ribosomal protein in Alzheimer's Disease (AD), as well as with the malfunctioning mRNA coding for the uS13 ribosomal subunit implicated in Parkinson's Disease (PD). Also, mRNAs coding amyloid precursor protein (APP), beta-secretase and α-synuclein also showed complete homology with CHC003 and CHC004 Chimerenomic RNA enzymes. 

As a result of these findings, the synthesized Chimerenomic RNA enzymes may be reclassified to reflect their specific associations with these neurodegenerative conditions. They can be referred to as Alzheimer’s and neurodegenerative disease (AND) Chimerenomic RNA enzymes 1, 2, 3, and 4 (for CHC001, CHC002, CHC003, and CHC004, respectively).

This classification not only highlights the potential therapeutic applications of these enzymes in targeting the underlying genetic code-based total RNA malfunctions associated with AD and PD but also emphasizes the importance of continued research into their mechanisms of action. By further exploring the roles of these AND Chi-RNA enzymes, we may unlock more strategies for combating many similar diseases.

4.4. Uses in early diagnosis of AD and PD

The synthesized Chimerenomic RNA enzymes hold significant promise for the early diagnosis of both Alzheimer's Disease (AD) and Parkinson's Disease (PD). Their unique properties can be leveraged in two primary ways:

4.4.1 Serum mRNA Assays:

The homologous sequences of the Chimerenomic RNA enzymes can be utilized as probes in serum mRNA assays. By targeting specific malfunctional mRNAs associated with AD and PD, these probes can help identify the presence of these diseased mRNAs in patients' cells and serum many years before the manifestation of disease symptoms. This approach will allow for a non-invasive method of screening that could facilitate early detection, enabling timely intervention and management of these neurodegenerative conditions.

4.4.2 Functional Chimerenomic Search Engine:

Another innovative application involves isolating and sequencing individual cell specific Chimerenomic RNA. By employing the AAPCR functional Chimerenomic search engine, research scientists can analyze the sequences for abnormalities linked to AD and PD. This method not only aids in identifying specific genetic markers associated with the diseases but also enhances our understanding of the underlying molecular mechanisms at play.

Together, these diagnostic strategies could revolutionize the way we approach the early detection of Alzheimer's and Parkinson's diseases. By enabling earlier and more accurate diagnoses, we can improve patient outcomes and tailor treatment plans more effectively, ultimately enhancing the quality of life for those affected by these challenging disorders.

4.5. Uses in Treatment and Cure of AD and PD

The Chimerenomic RNA enzymes, particularly CH001, CH002, CHC003 and CHC004, represent promising therapeutic remedies aimed at addressing Alzheimer's Disease (AD) and Parkinson's Disease (PD). Given their demonstrated ability to target and correct malfunctioning mRNAs associated with these neurodegenerative conditions, these agents are now poised for clinical trials.

The transition to clinical trials marks a significant milestone in the development of these innovative treatments. During these trials, research scientists and physicians will evaluate the safety, efficacy, and optimal dosing of CHC003 and CHC004 in human subjects. The goal is to determine how effectively these enzymes can restore the balance of genetic code-based RNAs and mitigate the symptoms or progression of AD and PD.

If successful, these clinical trials could pave the way for new, targeted therapies that not only address the underlying genetic malfunctions associated with these diseases but also improve the overall quality of life for patients. The potential impact of CHC003 and CHC004 on the treatment landscape for Alzheimer's and Parkinson's diseases is substantial, offering hope for the estimated 150 million people that could develop these conditions soon.

 

 

Figure 1.   CHC003

1 NTTCCCTTTTCACGACGGACGTTAGCACCCGCCGTGTGTCTCCCAGGCTCGGCACTTGTCGGTATTAGGAGTTTGCATCGGTTTGGTAAGTCGGGCTGACCCCCTAGCCGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGCT
2 NGTCAGTCAGTAGTATTTAGCCTTGGAGGATGGTCCCCCCATATTCAGACAAAGTTTCTCGTGCTCCGTCCTACTCGATTTCATGACTAAGAGATTTTCGCGTACAGGGCTATCACCCACTATGGCCGCACTTTCCAGAGCGTTCCGCTA
3 NTGGTATCTTCGACCGGCATGAGCTTACGGAGCAAGTCCTTCACCCTCACCGGCGCACCTTCTCCCGAAGTTACGGTGCCATTTTGCCTAGTTCCTTCACCCGAGTTCTCTCAAGCGCCTTGGTATTCTCTACCCAACCACCTGTAGATC
4 NGCCCACCATT….……………………..…………………………………………………

 

Up to 35,000,000 entries

Figure showing the first 3 Chimeres of the NTinti containing about 35,000,000 Chimeres. These were adapted from AAPCR Chimerenomics database. Full data available on https://chimerenomics.com dataset CHC003.

 

 

Figure 2.   CHC004

1 CGGCTAGGGGGTCATCCCGACTTACCAAACCGATGCAAACTCCGAATACCTACAAGTGCCGAGCATGGGAGACACACGGCGGGTGCTAACGTCCGTCGTGAAAAGGGAAAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCT
2 AGCGAACGGGGACTAGCCCTTAAGTGGCTTTGAGATTAGCGGAACGCTCTGGAAAGTGCGGCCATAGTGGGTGATAGCCCTGTACGCGAAAATCTCTTAGTCATGAAATCGAGTAGGACGGAGCACGAGAAACTTTGTCTGAATATGGGG
3 ACAGGTGGTTGGGTAGAGAATACCAAGGCGCTTGAGAGAACTCGGGTGAAGGAACTAGGCAAAATGGCACCGTAACTTCGGGAGAAGGTGCGCCGGTGAGGGTGAAGGACTTGCTCCGTAAGCTCATGCCGGTCGAAGATACCAGAGAT
4 TCGAAGCAACG…………………………………………………………………………….

 

Up to 35,000,000 entries

Figure showing the first 3 Chimeres of the NTinti containing about 35,000,000 Chimeres. These were adapted from AAPCR Chimerenomics database. Full data available on https://chimerenomics.com dataset CHC004.

 

 

 

 

 

Appendix

New Terminologies:

Chimerenomic glossary for the new terminologies in life sciences.

  1. These new terminologies in the life sciences describe the discovery of template-

independent RNA processes that control the survival of cells and organisms other than genes. The building blocks of this life regulatory system are made up of a unique type of RNA that are not coded nor synthesized through the genetic code. These template-independent RNAs are called chimerenomic RNAs.

  1. Chimerenomics: Is the study of everything (NTintis, chigramming, GDH-

chimmerization, chimere etc) about chimerenomic RNAs. Chimerenomics confers molecular chemistry pluripotency and totipotency to all cells and tissues. Chimerenomics are the processes by which whole organisms, cells and tissues differentiate, develop and grow by chigramming chimerenomic RNAs that interact with the changing physicochemical internal and external environmental conditions thereby reprogramming and optimizing those metabolic reactions that assure the continued survival of the organism.

  1. Chimere:  Is the minimum length of nucleotide sequence that can degrade homologous

mRNA and other genetic code-based RNAs. Chimere is the active segment of NTinti.

  1. NTinti: This is the chimerenomic RNA molecule chigrammed (synthesized) by NADH-

glutamate dehydrogenase hexameric redox cycle isoenzymes (GDH) in response to a specific environmental change. NTinti is also synthesized naturally in vivo during normal tissue differentiation, growth and development. Therefore, NTinti can be cell or tissue specific. One NTinti has more than one chimere.

  1. Chigramming: This is the process of synthesis of chimeres and NTintis by GDH. It is a

spontaneous process. It is the conversion of the electromagnetic changes in the environmental conditions of cells, tissues, whole organisms to the nucleotide sequences of chimerenomic RNAs.

  1. GDH-Chimerization: This is the formation of chemical Schiff base of GDH isoenzymes

in response to a new environment leading to new hexameric isoenzyme complexes. This is the initiation process for chigramming.

  1. Functional chimerenomics: This is the study of the biological functions of chimere and

NTinti.

  1. Differential chimerenomics: This is the comparison study of the chimeres and NTintis

from same or different tissues under various environmental conditions.

  1. Other terminologies

a). Clinical chimerenomics: The application of chimerenomics to clinical studies.

b). Chimerenomic Medicine: This is the application of chimerenomics to primary care in the prevention and treatment of human disorders, diseases and wellness conditions in humans.

c). Chimerenomic Chemistry

d). Chimerenomic Physiology

e). Molecular Chimerenomics

f). Chimerenomic Biology

g). Chimerenomic Pharmacology etc.

References

 

  1. Porsteinsson AP, Isaacson RS, Knox S, Sabbagh MN, Rubino I. (2021). Diagnosis of Early Alzheimer's Disease: Clinical Practice in 2021. J Prev Alzheimers Dis. 2021;8(3):371-386. doi: 10.14283/jpad.2021.23. PMID: 34101796.
  2. Park SW, Yeo NY, Lee J. et al. (2023). Machine learning application for classification of Alzheimer's disease stages using 18F-flortaucipir positron emission tomography. BioMed Eng OnLine 22, 40. https://doi.org/10.1186/s12938-023-01107-w
  3. Weintraub S, Carrillo MC, Farias ST, Goldberg TE, Hendrix JA, Jaeger J, Knopman DS, Langbaum JB, Park DC, Ropacki MT, Sikkes SAM, Welsh-Bohmer KA, Bain LJ, Brashear R, Budur K, Graf A, Martenyi F, Storck MS, Randolph C. (2018). Measuring cognition and function in the preclinical stage of Alzheimer's disease. Alzheimers Dement (N Y). 2018 Feb 13;4:64-75. doi: 10.1016/j.trci.2018.01.003. PMID: 29955653; PMCID: PMC6021264.
  4. Scheltens P, De Strooper B, Kivipelto M, Holstege H, Chételat G, Teunissen CE, Cummings J, van der Flier WM. (2021). Alzheimer's disease. Lancet. 2021 Apr 24;397(10284):1577-1590. doi: 10.1016/S0140-6736(20)32205-4. Epub 2021 Mar 2. PMID: 33667416; PMCID: PMC8354300
  5. Yang Y, Qiu L. (2024). Research Progress on the Pathogenesis, Diagnosis, and Drug Therapy of Alzheimer's Disease. Brain Sci. 2024 Jun 9;14(6):590. doi: 10.3390/brainsci14060590. PMID: 38928590; PMCID: PMC11201671
  6. Hippius H, Neundörfer G. (2003). The discovery of Alzheimer's disease. Dialogues Clin Neurosci. 2003 Mar;5(1):101-8. doi: 10.31887/DCNS.2003.5.1/hhippius. PMID: 22034141; PMCID: PMC3181715.]
  7. Zhagn L, Li Z. (2014). [Alzheimer and the discovery of Alzheimer's disease]. Zhonghua Yi Shi Za Zhi. 2014 Sep;44(5):288-90. Chinese. PMID: 25579215
  8. Drummond E, Nayak S, Pires G, Ueberheide B, Wisniewski T.(2018). Isolation of Amyloid Plaques and Neurofibrillary Tangles from Archived Alzheimer's Disease Tissue Using Laser-Capture Microdissection for Downstream Proteomics. Methods Mol Biol. 2018;1723:319-334. doi: 10.1007/978-1-4939-7558-7_18. PMID: 29344869; PMCID: PMC5811767.]
  9. Majdi A, Sadigh-Eteghad S, Rahigh Aghsan S, Farajdokht F, Vatandoust SM, Namvaran A, Mahmoudi J. (2020). Amyloid-β, tau, and the cholinergic system in Alzheimer's disease: seeking direction in a tangle of clues. Rev Neurosci. 2020 May 26;31(4):391-413. doi: 10.1515/revneuro-2019-0089. PMID: 32017704.
  10. Zheng H, Koo EH (2011). Biology and pathophysiology of the amyloid precursor protein. Molecular Neurodegeneration 6, Article 27.
  11. Vassar R, Bennett BD, Babu-Khan S, Khan S, Mendiaz EA, Denis P, Teplow DB, Ross S. et al. (1999). Beta-secretase cleavage of Alzheimer’s amyloid precursor protein by the transmembrane aspartic protease BACE. Science 286.5440.735.
  12. Selkoe DJ. (2008).Soluble oligomers of the amyloid beta-protein impair synaptic plasticity and behavior. Behav Brain Res. 2008 Sep 1;192(1):106-13. doi: 10.1016/j.bbr.2008.02.016. Epub 2008 Feb 17. PMID: 18359102; PMCID: PMC2601528.
  13. Kashif M, Sivaprakasam P, Vijendra P, Waseem M, Pandurangan AK. (2023). A Recent Update on Pathophysiology and Therapeutic Interventions of Alzheimer's Disease. Curr Pharm Des. 2023;29(43):3428-3441. doi: 10.2174/0113816128264355231121064704. PMID: 38038007.
  14. Bagga S, Kumar M. (2023). Current Status of Alzheimer's Disease and Pathological Mechanisms Investigating the Therapeutic Molecular Targets. Curr Mol Med. 2023;23(6):492-508. doi: 10.2174/1566524022666220404112843. PMID: 35379149
  15. Ashrafian H, Zadeh EH, Khan RH. (2021). Review on Alzheimer's disease: Inhibition of amyloid beta and tau tangle formation. Int J Biol Macromol. 2021 Jan 15;167:382-394. doi: 10.1016/j.ijbiomac.2020.11.192. Epub 2020 Dec 2. PMID: 33278431.
  16. Singh AK, Mishra G, Maurya A, Awasthi R, Kumari K, Thakur A, Rai A, Rai GK, Sharma B, Kulkarni GT, Singh SK. (2019). Role of TREM2 in Alzheimer's Disease and its Consequences on β- Amyloid, Tau and Neurofibrillary Tangles. Curr Alzheimer Res. 2019;16(13):1216-1229. doi: 10.2174/1567205016666190903102822. PMID: 31481003.
  17. Yang Y, Qiu L. (2024). Research Progress on the Pathogenesis, Diagnosis, and Drug Therapy of Alzheimer's Disease. Brain Sci. 2024 Jun 9;14(6):590. doi: 10.3390/brainsci14060590. PMID: 38928590; PMCID: PMC11201671
  18. Gao, C., Jiang, J., Tan, Y. et al. (2023). Microglia in neurodegenerative diseases: mechanism and potential therapeutic targets. Sig Transduct Target Ther 8, 359 (2023). https://doi.org/10.1038/s41392-023-01588-0
  19. Palmqvist S, Schöll M, Strandberg O, Mattsson N, Stomrud E, Zetterberg H, Blennow K, Landau S, Jagust W, Hansson O.(2017). Earliest accumulation of β-amyloid occurs within the default-mode network and concurrently affects brain connectivity. Nat Commun. 2017 Oct 31;8(1):1214. doi: 10.1038/s41467-017-01150-x. PMID: 29089479; PMCID: PMC5663717.
  20. Tiwari S, Atluri V, Kaushik A, Yndart A, Nair M. (2019). Alzheimer's disease: pathogenesis, diagnostics, and therapeutics. Int J Nanomedicine. 2019 Jul 19;14:5541-5554. doi: 10.2147/IJN.S200490. PMID: 31410002; PMCID: PMC6650620
  21. Alberts B, Johnson A, Lewis J, et al. (2002). Molecular Biology of the Cell. 4th edition. New York: Garland Science; 2002. From RNA to Protein. Available from: https://www.ncbi.nlm.nih.gov/books/NBK26829/
  22. Majernikova N, Marmolejo-Garza A, Salinas CS, Luu MDA, Zhang Y, Trombetta-Lima M et al. (2024). The link between amyloid beta and ferroptosis pathway in Alzheimer’s disease progression. Cell Death Dis 15 (10), 782.
  23. Ding Q, Markesbery WR, Chen Q, Li F, Keller JN. (2005). Ribosome dysfunction is an early event in Alzheimer's disease. J Neurosci. 2005 Oct 5;25(40):9171-5. doi: 10.1523/JNEUROSCI.3040-05.2005. Erratum in: J Neurosci. 2006 Mar 15;26(11):3077. PMID: 16207876; PMCID: PMC6725754. 
  24. Kouli A, Torsney KM, Kuan WL. (2018). Parkinson’s Disease: Etiology, Neuropathology, and Pathogenesis. In: Stoker TB, Greenland JC, editors. Parkinson’s Disease: Pathogenesis and Clinical Aspects [Internet]. Brisbane (AU): Codon Publications; 2018 Dec 21. Chapter 1. Available from:https://www.ncbi.nlm.nih.gov/books/NBK536722/ doi: 10.15586/codonpublications.parkinsonsdisease.2018.ch1
  25. Muñoz, J.M., Williams, J.T. & Lebowitz, J.J. (2025). Morphological and functional decline of the SNc in a model of progressive parkinsonism. npj Parkinsons Dis. 11, 24 (2025). https://doi.org/10.1038/s41531-025-00873-9
  26. Cramb KML, Beccano-Kelly D, Cragg SJ, Wade-Martins R. (2023). Impaired dopamine release in Parkinson's disease. Brain. 2023 Aug 1;146(8):3117-3132. doi: 10.1093/brain/awad064. PMID: 36864664; PMCID: PMC10393405.
  27. Noor A, Zafar S, Zerr I. (2021). Neurodegenerative Proteinopathies in the Proteoform Spectrum-Tools and Challenges. Int J Mol Sci. 2021 Jan 22;22(3):1085. doi: 10.3390/ijms22031085. PMID: 33499319; PMCID: PMC7865347
  28. Tang T, Jian B, Liu Z. (2023). Transmembrane Protein 175, a Lysosomal Ion Channel Related to Parkinson's Disease. Biomolecules. 2023 May 9;13(5):802. doi: 10.3390/biom13050802. PMID: 37238672; PMCID: PMC10216561.
  29. Lee S, Park SM, Ahn KJ, Chung KC, Park SR, Kim J (2009). Identification of the amino acid sequence of α-synuclein responsible for macrophage activation. Biochemical and Biophysical Research Communications 381: 39-43.
  30. Chen, L., Chehade, H.D. & Chu, HY. (2025). Motor cortical neuronal hyperexcitability associated with α-synuclein aggregation. npj Parkinsons Dis. 11, 18 (2025). https://doi.org/10.1038/s41531-024-00867-z
  31. Droby, A., Yoffe-Vasiliev, A., Atias, D. et al. (2025). Radiological markers of CSF α-synuclein aggregation in Parkinson’s disease patients. npj Parkinsons Dis. 11, 7 (2025). https://doi.org/10.1038/s41531-024-00854-4
  32. Lee  JH, Han J, Kim  H, Park SM, Joe  E, Jou I (2019). Parkinson's disease-associated LRRK2-G2019S mutant acts through regulation of SERCA activity to control ER stress in astrocytes. Acta Neuropathology Commun. 2;7(1):68. Doi: 10.1186/s40478-019-0716-4.
  33. Vassar R, Bennett BD, Babu-Khan S, Khan S, Mendiaz EA, Denis P, Teplow DB, Ross S. et al. (1999). Beta-secretase cleavage of Alzheimer’s amyloid precursor protein by the transmembrane aspartic protease BACE. Science 286.5440.735.
  34. Okea RN, Osuji GO (2024). Transformation from growth to aging in human astrocyte cell cultures: The role of NADH-glutamate dehydrogenase isoenzymes. JAAPCR Vol. 1, issue 3.
  35. Osuji GO, Braithwaite C, Fordjour K, Madu WC, Beyene A, Roberts PS, Wright V (2003). Purification of glutamate dehydrogenase isoenzymes and characterization of their substrate specificities. Preparative Biochemistry & Biotechnology 33: 13-28.
  36. Osuji GO, Madu WC, Johnson PM (2021). Electrophoretic purification and characterization of human NADH-glutamate dehydrogenase redox cycle isoenzymes synthesizing nongenetic code-based RNA enzyme. Advances in Enzyme Research 9: 19-35.
  37. Lowry OH, Rosenbrough NJ, Farr AL, Randall RJ (1951). Protein measurement with Folin phenol reagent. The Journal of Biological Chemistry, 193: 265-275.
  38. Berns KI, Bond EC, Manning FJ, editors. (1996). Resource Sharing in Biomedical Research. Washington (DC): National Academies Press (US); 1996. 2, The American Type Culture Collection. Available from: https://www.ncbi.nlm.nih.gov/books/NBK209072/
  39. Osuji GO, Okea RN (2024). The chimerenomic pump: Large-scale production of glutamate dehydrogenase-synthesized RNAs. JAAPCR Vol. 1: issue 2.
  40. Osuji GO, Okea RN (2024). Environment-wide reprogramming of total RNA abundance and metabolic processes by glutamate dehydrogenase-synthesized RNA enzyme: Terminologies for the new RNAs. JAAPCR Vol. 1, issue 1.
  41. Osuji GO, Brown TK, South SM (2008). Discovery of the RNA synthetic activity of glutamate dehydrogenase and its application in drug metabolism research. The Open Drug Metabolism Journal. 2: 1-13.
  42. Osuji GO, Braithwaite C, Pointer R, Reyes J (1999). Pesticide inactivation of peanut glutamate dehydrogenase: Biochemical basis of the enzyme’s isomerization. J. Agric. & Food Chem. 47: 3345-3351.
  43. Leung SK, Jeffries AR, Castanho I, Jordan BT, Moore K, Davies JP, Dempster EL, Bray NJ, O'Neill P, Tseng E, Ahmed Z, Collier DA, Jeffery ED, Prabhakar S, Schalkwyk L, Jops C, Gandal MJ, Sheynkman GM, Hannon E, Mill J.(2021). Full-length transcript sequencing of human and mouse cerebral cortex identifies widespread isoform diversity and alternative splicing. Cell Rep. 2021 Nov 16;37(7):110022. doi: 10.1016/j.celrep.2021.110022. PMID: 34788620; PMCID: PMC8609283.
  44. Makhlouf  L, Peter JJ, Magnussen HM, Thakur R, Millrine D, Minshull TC, Harrison  G, Varghese J,  Lamellate F, Foglizzo M, Macartney T, Calabrese AN,  Zeqiraj E, Kulathu Y (2024). The UFM1 E3 ligase recognizes and releases 60S ribosomes from ER translocons. Nature. 627(8003):437-444. Doi: 10.1038/s41586-024-07093-w
  45. Sinha S, Anderson JP, Barbour R, Basi GS, Caccavello R, Davis D et al. (1999). Purification and cloning of amyloid precursor protein beta-secretase from human brain. Nature 402 (6761) 537-540.
  46. Ueda K, Fukushima H, Mesliah E, Xia Y, Iwan A, Yoshimoto M et al. (1993). Molecular cloning of cDNA encoding an unrecognized component of amyloid in Alzheimer disease. Proc. Natl. Acad. Sci. USA 90: 11282-11286.
  47. Finkel T, Holbrook N J. (2000). Oxidants, oxidative stress and the biology of ageing. Nature 408, 239–247. 10.1038/35041687
  48. Zhang X, Fu Z, Meng L, He M, Zhang Z. (2018). The Early Events That Initiate β-Amyloid Aggregation in Alzheimer's Disease. Front Aging Neurosci. 2018 Nov 13;10:359. doi: 10.3389/fnagi.2018.00359. PMID: 30542277; PMCID: PMC6277872.
  49. Kong Q, Lin CL (2010). Oxidative damage to RNA: mechanisms, consequences, and diseases. Cell Mol Life Sci. 2010 Jun;67(11):1817-29. doi: 10.1007/s00018-010-0277-y. Epub 2010 Feb 11. PMID: 20148281; PMCID: PMC3010397.
  50. Brown TA (2002). Genomes. 2nd edition. Oxford: Wiley-Liss; 2002. Chapter 1, The Human Genome. Available from: https://www.ncbi.nlm.nih.gov/books/NBK21134/
  51. National Research Council (US) Committee on Mapping and Sequencing the Human Genome (1988). Mapping and Sequencing the Human Genome. Washington (DC): National Academies Press (US); 1988. 2, Introduction. Available from: https://www.ncbi.nlm.nih.gov/books/NBK218247/