The detailed scientific engagement of opioid overdose disorder and treatment; and the illumination of their clinical and pharmacological mechanisms are a tale of the victory by humankind over a network of related inexplicable chemical disease conditions. But much more needs to be understood. The analgesic properties of morphine molecules enable it to fit into specific receptor sites on a nerve cell. Opioid chemical binding to the neuro-receptor is same as opioid binding to the hexameric isoenzymes of NADH-glutamate dehydrogenase (GDH) to chigram chimerenomic RNA (refer to Appendix 1 for new terminologies) enzymes, whose functions are to degrade homologous alternatively spliced, superfluous mRNAs, rRNAs etc that cause health disorders. Therefore, opioid overdose disorders have two components: neurological disarrangement and molecular chemistry rearrangement; only the neurological disorders being treated, while the molecular chemistry disorders are not studied. We have invented protocols that have provided GDH molecular imageries of the progression of opioid addiction. The snapshot taken at 0.135 mM morphine concentration was the GDH threshold alert for feeling of euphoria; threshold at 0.27 mM morphine concentration was the GDH alarm for intoxication; and the threshold at 1.1 mM morphine concentration was the GDH red flag for full-blown opioid addiction. The double backbone of drug addiction treatment and prevention has been broken. The macromolecular (NTinti) chimerenomic RNA enzymes chigrammed by redox cycle GDH at the 0.135 mM, 0.27 mM, and 1.1 mM morphine threshold concentrations were preconditioned by the morphine physicochemical environments, and they degraded all of the alternatively spliced, mutated, superfluous variant mRNAs for protein kinases, neuro-receptor (mu, kappa, delta) proteins, blood brain barrier p120-glycoprotein-adherens junction protein complexes, synapsin, glutamate receptor proteins, GABA receptor proteins, dopamine receptor protein, serotonin receptor protein, enkephalin receptor proteins, cytochrome P450 monooxygenase, Cu/Zn SOD, GSH S-transferase, ABC transporter, alternative oxidase, lipases; all of which are known to function in the addiction metabolic pathways. Thus, chimerenomic inventions in molecular chemistry, pharmacology, and medicine are ready to complement with neurosciences to cure and prevent opioid overdose disorders, and addiction. Our inventions in chimerenomic chemistry and medicine are also applicable to prevent and treat drug addiction in general.
Godson O. Osuji and Remigius N. Okea, American Academy of Primary Care Research, San Antonio, Texas, USA
1.0. Introduction: Molecular Chemistry in the Functions of Astrocyte Cells.
1.1. Molecular Chemistry: Physician research scientists have demonstrated that drug misuse addiction causes structural changes to the brain circuits that regulate the feeling of euphoria, self-control, and stress [1] Although scientists and sociologists are applying this emerging medical knowledge, morbidity of drug misuse is still on the rise [2] because more research is needed to describe opioid addiction in a molecular language that opens a highway to innovative therapy.
Chronic pain is the reason many patients resort to the administration of opioid analgesics, which have caused opioid overdose disorder, dependency, and epidemic affecting about 20% of adults worldwide or 1.5 billion people [3]. Ordinarily, prescription opioids are safe for the management of pain [4; 5; 6]. However, dependency and public health crises arise when opioids are used in excess. It is refreshing to understand the genes that regulate the transmission of pain signals [7]. Traditional pharmaceutical and pharmacological research projects are yet to perfect designer molecules that inhibit those gene products [8]. A review of literature on substance abuse, dependency, and withdrawal syndromes shows an overriding need to explore the phenomena in terms of the molecular chemistry of the addictive drug molecules. There is a wide yawning gap in the understanding of analgesic structure and action in relation to chemical and physiological reactions in cells, tissues, organs and the whole body of the drug-dependent patient. New understanding of the molecular chemistry of pain, and in terms of the responses of the metabolic pathways to the addictive drug molecules at the mRNA level must guide the design of the biological macromolecules that would prevent substance abuse/dependency.
The advances in the psychostimulant nuclear medicine of the brain [9] need to be integrated with other scientific areas including biochemistry, molecular chemistry, and nutrition to leverage translational approaches to treat substance use disorders. Molecular chemistry is the deployment of chemistry to decipher inexplicable phenomena in molecular and cell biology. Drug overdose disorder, treatment of chemical dependency, withdrawal syndrome, social disarrangement of the addicted, etc embody inexplicable phenomena in molecular and cell biology. Some biological and environmental factors promoting brain and behavior changes are being unraveled [4]. A good news is that morphine biochemical pathway is about the same enzyme-catalyzed equilibrium reaction steps in human cells and tissues as in the opium poppy plant cells and tissues[10; 11; 12], thus making it possible to apply the innovative macromolecular chimerenomic (nongenetic code-based) RNA enzymes [10, 13; 14; 15] to selectively degrade the superfluous mRNAs encoding the enzymes that dysregulate morphine neurotransmitter functions, and consequently to improve the treatment of opioid overdose disorders.
The convergent objective of this research plan was to deploy wide ranges of molar concentrations of morphine in the rigorous chimerenomic parallelogram of controls to recreate NADH-glutamate dehydrogenase isoenzymes, and to produce the redox cycle hexameric isoenzyme complexes so that they can be applied to catalyze the synthesis of macromolecular chimerenomic RNA enzymes for treatment and re-setting of the neurological, and biochemical sequences of nervous pain signal transmission to the brain, and offering a translational/transformational innovative prevention management for opioid overdose disorders.
Many human health disorders are caused by superfluous alternatively spliced mRNA, long non-coding RNAs, rRNAs, tRNAs that should have been prevented from entering protein translational processes[10; 16]. Other mRNAs whose product proteins are misfolded in the drug addiction pathways include those for mu, delta, and kappa opioid receptors, and for glutamate receptors [17; 18; 19; 20; 21; 22; 23]. Others include GABA receptors, dopamine receptor, serotonin receptor, enkephalin receptors. Therefore, an expanding aim of the research program was to apply chimerenomic research protocols to prepare chimerenomic macromolecular RNA enzymes with chemical activity to degrade superfluous homologous mRNAs of opioid and related receptor proteins. Two other tributaries of the opioid addiction pathway involve the kinases and the cytochrome P450 monooxygenase-dependent degradation of drugs. Kinases drive addiction because they are seen in virtually every signaling pathway in normal health and disease conditions [24]. But some eukaryotic kinase proteins are products of mutated mRNAs [25] resulting to malfunctional, misfolded, and dysregulated variant polypeptides. In the pathways into drug metabolizing enzymes [26], the mRNAs encoding human phospholipase A1, cytochrome P450 2E1, superoxide dismutase [Cu/Zn], alternative oxidase, glutathione S-transferase, and ABC transporter also do suffer from mutagenesis resulting to dysfunctional protein variants [27; 28; 29; 30; 31].
The objective of this project included the application of chimerenomic macromolecular RNA enzymes to clean out the mutated mRNAs, and preventing them from being translated, thereby offering an additional novel medical and pharmacological approach for treating opioid addiction.
Drug addiction is an out-of-control feeling that one must use a drug and continue to use it even though it causes harm repeatedly. Morphine is highly addictive, largely because it triggers powerful reward centers in the brain. It triggers the release of endorphins, the committed step in the addiction pathway [32]. It tells the brain that the person feels good. Endorphins make it less likely that you will feel pain. It also boosts feelings of pleasure. This creates a sense of well-being that is powerful but lasts only a short time. When a morphine dose wears off, the person finds himself wanting those good feelings back urgently. This is how opioid use disorder begins. The initial strong binding of opioid molecules to endorphin receptor proteins followed by the attenuation of that binding and accompanied by cravings to increase the opioid doses consumed are behavioral signs that implicate endorphins as the culprits to drug addiction.
When morphine or other opioids are uploaded into the body over a long time, the body does not make as many endorphins; the same dose of opioids does not make the person feel as good. So, the opioid doses are raised to keep the body feeling good. If they do not raise their doses, they start having withdrawal symptoms, including worsening pain [32].
This research project therefore expanded its objectives beyond the neurological management of drug addiction to include the functional chimerenomics analyses of the numerous codons misused in the post-transcriptional alternative splicing events of the mRNA (accession number M38297) encoding the beta-endorphins [33], and the mRNA (accession number BC032505) encoding the enkephalins [34].
Opium chemicals (morphine, heroin, codeine and their metabolic derivatives) are strong nucleophilic alkaloids possessing similar chemical structures. Opioid alkaloid chemical reaction with the neuro-receptor protein is same as that which opioid molecules also utilize for binding to the hexameric isoenzymes of NADH-glutamate dehydrogenase Schiff-base complex [35] in the redox cycle chigramming of chimerenomic RNA enzyme (please refer to Appendix 1 for the terminologies) enzymes [15], whose functions are to degrade homologous mRNAs, rRNAs, long noncoding RNAs that are superfluous [13; 36; 37; 38; 39]. The analgesic properties of morphine molecules are related to the ability to fit into and to inhibit a specific receptor site on a nerve cell. This competitive inhibition eliminates the action of the pain on the receptor, thereby blocking the pain signals from reaching the brain. The shape of the morphine molecule is important for fitting it into the active site of the receptor [40; 41]. The benzene group of the morphine molecule fits snugly in the flat section of the receptor protein, whilst the curved neighboring group of carbon atoms fits into the adjacent groove, allowing the quaternary nitrogen atom to attach to the anionic group on the receptor, so locking the two molecules together. Therefore, opioid overdose disorders have two components: neurological disarrangement [4], and molecular chemistry rearrangement. Both the neurological disorders and the molecular chemistry disorders need to be studied in parallel. This research project seeks to describe the molecular chemistry invention on opioid overdose disorder, addiction, treatment, and prevention.
1.2. Functions of Human Astrocyte Cells: Exploration of Human Astrocyte Cells (HACs) is crucial for advancing our understanding of the central nervous system (CNS) and its intricate functions. Despite the growing body of research surrounding various pharmacological agents, the direct effects of morphine addiction on brain development remain largely uncharted territory.
Astrocytes are the predominant cell type in the CNS, constituting a significant portion of the cellular volume—ranging from 25% to 50% in certain brain regions [13]. Remarkably, they outnumber neurons by more than fivefold, underscoring their importance in maintaining CNS homeostasis. These versatile cells exhibit diverse morphological and physiological forms, each tailored to fulfill specific functions in neural signaling and support. Recent studies have highlighted the involvement of astrocytes in synapse formation, synaptic function, and the regulation of blood flow within the brain, emphasizing their integral role in both normal and pathological processes [16].
Astrocytes are classified into two main subtypes: protoplasmic astrocytes, predominantly found in the gray matter, and fibrous astrocytes, which are primarily located in white matter [16]. Both subtypes play vital roles in synaptic formation, neural cell development, and the regulation of cerebral blood flow. They are also key players in neural plasticity, a fundamental process that underlies learning and memory. Moreover, astrocytes express receptors for a variety of neurotransmitters and have the capacity to release numerous neuroactive and trophic factors, many of which remain to be discovered. The functional significance of this signaling is still shrouded in mystery, but it is likely to be pivotal in controlling synaptic development, blood vessel dynamics, and neuronal survival.
Thus, the study of opioid addiction using human astrocyte cells as the experimental organism is not only essential and rigorous for understanding the effects of morphine but also for unraveling the complex functions these cells play in the CNS. The strategy and approach of this study are novel because they represent a considerable shift in the trajectory of research within neurology and neuroscience. By moving away from broad, aimless investigations, we are now homing-in on direct interventions at the chemical, molecular, cellular, tissue and whole organism levels. This focused approach is not merely an academic exercise; it serves as a precursor to clinical seamlessly and directly from preclinical results, representing a transition that can expedite the often-lengthy process of clinical studies. Understanding the specific molecular signaling pathways influenced by morphine in astrocyte cells allows scientists to identify the precise mechanisms that underlie the highway to the cure of drug addiction. This innovative chemical knowledge is crucial for developing targeted therapies that maximize therapeutic benefits on patients while minimizing the risks of adverse side effects. Therefore, this research marks a transformative moment in our understanding of morphine addiction.
2.0. Methods and Materials
2.1 American Academy of Primary Care (AAPCR): Astrocyte Cell Culture Project: A Groundbreaking Study on Opioid Addiction, Prevention and Treatment Using Human Astrocyte Cell as Experimental Organism.
2.2. Experimental Design and Rigor: In this study, human astrocyte progenitor lines were sourced from iXcell Biotech, with established protocols employed by the Southwest Research Institute (SwRI) to cultivate the cultures effectively [16]. The experimental phase spanned a total of 11 days, during which meticulous and rigorous monitoring micrographic documentation of cellular developments was conducted to ensure accurate observations of growth and response to treatments. To facilitate a robust comprehensive comparison, cultures were organized into duplicates, resulting in two control groups viz:
Control Group A and three morphine treatments:
0.137 mM morphine Group A,
0.27 mM morphine Group A,
1.1 mM morphine Group A;
and Control Group B and three morphine treatments:
0.137 mM morphine Group B,
0.27 mM morphine Group B,
1.1 mM morphine Group B.
All the eight flasks were uniformly seeded with 5,000 cells/ml, totaling 375,000 cells per T-75 flask, and they exhibited an impressive cell viability rate of 98.3% at the outset. Throughout the duration of the study, each flask was maintained at a constant volume of 10 mL of cell culture medium, tailored to the specific conditions of each group. To ensure the integrity of the experimental rigor, both the cell seeding concentrations and media volumes remained constant for the entirety of the study.
Daily media exchanges were performed to maintain optimal growth conditions, with the new media for the morphine groups consistently containing the predetermined concentration of morphine. This approach ensured that the concentrations of morphine remained stable across all treatment flasks, allowing for a clear assessment of its effects on the growth and viability of human astrocyte progenitor cells.
Through this innovative and carefully controlled experimental design, we aimed to elucidate the impact of morphine concentrations on the addiction processes, and on astrocyte progenitor cells, contributing valuable insights into its pharmacological effects and potential therapeutic applications of chimerenomic RNA enzymes in neurological research.
2.3. Preparation of astrocyte medium and morphine concentrations
The preparation of Astrocyte Medium was conducted following the protocol provided by iXcell. Initially, key components including Fetal Bovine Serum (FBS), Growth Supplement, and Antibiotic-Antimycotic (Anti-Anti) were thawed in a 37°C water bath to ensure optimal conditions for mixing. To achieve a homogeneous mixture, the thawed components were gently tilted multiple times before incorporation into the medium. All subsequent steps were performed under aseptic conditions within a Biological Safety Cabinet (BSC) to maintain sterility. Specifically, 50 mL of FBS, 1 mL of Growth Supplement, and 5 mL of Antibiotic-Antimycotic were added to 500 mL of iXCell HA medium. The mixture was thoroughly combined to ensure even distribution of the components. The final concentrations in the Astrocyte Medium were established as follows: 10% FBS, 0.2% Astrocyte Supplement, and 1% Anti-Anti. Following the preparation of the Astrocyte Medium, drug-infused media formulations were created. To prevent contamination during cell culture, all media infused with non-sterile drugs were sterilized by filtration through a 0.22 μm sterile filter within the BSC [16].
2.4. Morphine Media Solution Preparation
The morphine Media Solution was prepared using medical-grade morphine base monohydrate. A stock solution of 110 mM morphine was prepared by dissolving 310 mg of the morphine to make 10 mL with the complete astrocyte nutrient medium. Dilutions of the stock solution with astrocyte medium taking into account the volume of the seeding astrocyte cells, to a maximum of 10 ml of
---1.1 mM morphine solution,
---0.27 mM morphine solution
----0.137 mM morphine solution.
Each solution was then filtered through a 0.22 μm sterile filter to ensure sterility [13].
2.5. Harvesting Protocol
For the experimental groups, meticulous harvesting was conducted at specific time points.
Control A and group A experiments were harvested on day 9, at the confluency point. In contrast, Control B and group B experiments were harvested on day 11, two days post-confluency. This detailed protocol ensures the integrity of the Astrocyte Medium and the accurate preparation of morphine concentrations, facilitating reliable experimental outcomes in subsequent analyses.
2.6. Human Astrocyte Cell (HAC) Culture Protocol:
Culture protocols from the American Type Culture Collection (ATCC) [42; 43; 44], were utilized. Upon receipt of the frozen human astrocytes (HA) cells, they were allowed to acclimate in vapor phase of liquid nitrogen for a period of 24 hours.
Media Preparation: Astrocyte Medium was prepared according to the following protocol provided by iXcell1 (see section 2.3. above). The Astrocyte Medium was then aliquoted into 50 mL conical tubes, with each tube containing 30 mL of the medium. The reconstituted medium remains stable for one month when stored at 4°C, with minimal exposure to light.
2.7. Thawing and Seeding of HACs: Thawing of frozen HA cells was performed following the described protocol [16]. The cells were thawed by placing the vial in a 37°C water bath with gentle agitation for approximately 1 minute, ensuring the cap remained outside the water to minimize contamination risks. Subsequently, the cells were carefully pipetted into a 15 mL conical tube containing 5 mL of fresh, warm Astrocyte Medium. Centrifugation at 1000 rpm (~220 g) for 5 minutes at room temperature followed, which allowed for the separation of cells from cryopreservation media. The supernatant was then removed, and the cells were re-suspended in 1mL of medium. To assess cell viability and quantity, a 20 µL sample of the cell solution was diluted with 180 µL of fresh medium and gently agitated to ensure thorough mixing. The diluted sample was analyzed using an NC200 cell counter, and values including cell passage, number of cells, viability, and diameter were recorded. The cells were cultured at a concentration of 5000 cells/cm2 into a T-75 flask, using 10 mL of medium volume. It was ensured that the conical tube was thoroughly washed to ensure all cells were successfully seeded.
A total of 375,000 cells were seeded per flask to initiate the culture process.
2.8. Daily Media Changes: The process of changing the media for the cultures was performed according to the following protocol. First, media was warmed at 37°C for 20 minutes while ensuring proper mixing. The flasks were removed from the incubator and placed in the biological safety cabinet (BSC), and using a serological pipette, the old media was carefully removed from the flask and collected in labeled containers accordingly, this way preserving the spent media. The labeled spent media were preserved in a freezer (-20°C). At this point, 10 ml of fresh Astrocyte media were pipetted into the flasks, each time, using a new pipet to avoid contamination and to maintain the exact aliquots. This process was repeated over and over until all the media was changed in all the flasks. Astrocyte culture media was changed this way daily.
2.9. Procedure for Harvesting Astrocytes: The harvesting of astrocytes was meticulously executed following a detailed and methodical approach, as outlined in previous studies [16]. The process was divided into two distinct phases, which were critical to understanding cell behavior under varying growth conditions. In the initial phase, two conditions were established for culturing the cells: Condition A—where cells were allowed to grow to confluency, and Condition B—where cells were permitted to continue growth up to two days past confluency. Control charts presented in Figure 1 [16] served as benchmarks to monitor the growth stages of experimental groups A and B. The cells from both groups were harvested upon reaching their designated growth status.
For both Group A (confluence at 9 days) and the Group B (post confluence at 11 days), the astrocyte cells Harvesting Process is outlined as follows:
1. The cell culture medium was carefully decanted and discarded.
2. A quick wash was performed using 5 mL of sterile phosphate-buffered saline (PBS) to eliminate any remaining growth medium.
3. After the wash, 4 mL of Trypsin/EDTA was added to the cells, and they were incubated at 37 °C for 2 minutes to promote detachment.
4. The enzymatic activity was halted by adding 10 mL of complete cell culture medium.
5. The cells were then gently centrifuged at 220 X g for 5 minutes to pellet the cells.
6. The resulting pellet was re-suspended in 1 mL of fetal bovine serum (FBS) for subsequent analysis.
A comprehensive cell count was conducted to evaluate important parameters, including passage number, total cell count, percentage viability, and cell diameter. For long-term preservation, the harvested cells were cryopreserved in a solution containing 10% dimethyl sulfoxide (DMSO) with culture medium [16].
The techniques utilized throughout the astrocyte cell culture and harvesting process align with the established standards set by organizations such as the American Type Culture Collection (ATCC) and various respected research institutions and universities. This meticulous protocol not only guarantees reproducibility but also bolsters the reliability and credibility of the research findings in the field of cellular neuroscience [16].
The multiple layers of controls and pair-wise comparison in this experimental design is to enhance reproducibility, reduce inter-observer variability, and produce valid results based on systematic application of intervention while keeping other variables constant.
Experiments should not be designed merely to satisfy a statistical exercise by creating triplicates to demonstrate statistical measures of centrality like means, standard deviations and more for a group of data, and then fail to answer any scientific question for which it was designed to do. This raises questions on the use of triplicates in cell culture protocol. Singer et al [45] have shown that when the intraclass correlation coefficient (cf) is greater than 50% (0.5) there is not a lot of gain to make triplicate observations. With a correlation coefficient equal to and greater than 0.75, triplicate design can only reduce the confidence interval for a single intraclass or interclass observation by only about 8% making it not worthwhile to make a triplicate design. The correlation coefficient in our study is greater than 0.95 discouraging the use of triplicate. A pre-experiment study was used to determine the appropriateness to opt out of triplicate design when a large correlation is demonstrated as we did in this study.
Similarly, when cell cultures are grown from same or similar cell lines and the growth protocols are congruent and identical, in such cases it is well expected that a large correlation coefficient is certain especially when the culture conditions are identical. In our study it is well established that HAC from iXcells have already known growth pattern under the same culture media provided and applying the same culture protocol as prescribed. This approach for conducting experiments on cell lines by interlinking cell culture and dose- response study experiments like we have done with Gabapentin [13] here is certainly unique and innovative. It allowed us to design the experiment embedding, at the same time, intra and inter experimental checks and controls that validate reliability and reproducibility of the experiment. As the debate on how best to improve the reproducibility of in vitro studies in the life sciences continues, we took a diligent approach starting from experimental design, use of internal controls, use of comparable external control, performed direct visual observation with microscopy and daily imaging, and followed the trends and data correlation factors. When all these are put together, confidence in the reproducibility of the study becomes obvious. Our approach does not discount the good recommendations put forward by [46; 47] that cell culture scientists should follow in order to minimize internal and external errors in order to improve reproducibility of experiments, but rather, our method adds to those recommendations. (See our detailed methodology section), We demonstrated in this study, however, that our design simplifies experimentation design, and cuts down costs by limiting the number of technical and biological replicates needed to show reproducibility by building internal and external controls and by incorporating an escalating dose response model as a testament to internal validity and reproducibility [16].
2.10. Extraction of the NADH-Glutamate dehydrogenase isoenzymes from human astrocyte cells and chemical conversion to redox cycle hexameric GDH.
2.10.1 Free Solution Isoelectric Focusing: Each of the experimental Group A and Group B human astrocyte cell cultures harvested on day 9 at cell confluency (120,000 cells), and harvested on day 11 at post confluency (120,000 cells) were applied for the purification according to the methods of [15] without any modification.
Essentially the pellet of the 120,000 cells was homogenized in 80 mL of 15 mM Tris-HCl buffer solution, pH 7.5, containing 20 µL β-mercaptoethanol, 2 Units of DNase 1, and 1 Unit of RNase A for 1 min at maximum speed. The homogenate was left to stand at room temperature for 30 min for DNA and RNA to be degraded. Protein precipitated by solid (NH4)2SO4 between 20% and 55% saturation of the homogenate was collected by centrifugation (10,000 x g, 30 min, 5˚C). The pellet was resuspended in minimum volume of 15 mM Tris-HCl pH 7.5 buffer solution, and dialyzed in 5 L of 15 mM Tris-HCl buffer solution pH 8.5; with three changes of the buffer solution over a period of 36 h.
The dialyzed extract was made up to 50 mL with 10 mM Tris-HCl buffer pH 7.5, and subjected to Rotofor (Bio-Rad, Hercules, CA) isoelectric focusing fractionation. Rotofor fractions were dialyzed in 5 L of 10 mM Tris-HCl buffer solution pH 8.5 also at 5˚C; with three changes of the buffer over a period of 36 h to remove the ampholyte and urea.
2.10.2. Polyacrylamide Gel Electrophoresis: Aliquots (250 µL) of the dialyzed Rotofor fractions were subjected to Laemmli SDS 12% polyacrylamide gel electrophoresis (PAGE) (100 V, 14 h, 4˚C) to remove other proteins and nucleic acids. Protean II xi electrophoresis cell (Bio-Rad, Hercules, CA) was used. The electrophoresed gels were washed three times with 0.15 mM Tris base at 5˚C to remove the SDS. One gel was thereafter stained with L-glutamate-NAD+-phenazine methosulfate-tetrazolium blue reagent at room temperature. The GDH hexameric redox cycle isoenzyme distribution pattern was photo documented. Rotofor purification was repeated two or three times to assure reproducibility of the GDH isoenzyme pattern per experimental astrocyte cultured cells. The second electrophoresed gel was applied for the elution of the redox cycle GDH hexameric isoenzyme complexes contained therein.
2.10.3. Whole Gel Elution of the Hexameric Isoenzymes: The stained polyacrylamide gel (PAG) as template was placed under the unstained PAG on a light box to cut out the section of the unstained PAG containing the redox cycle GDH hexameric isoenzyme complexes as already described [15]. The GDH isoenzymes were electro-eluted from the excised piece of PAG using Bio-Rad mini-whole gel eluter at subzero temperature. The whole-gel purified GDH isoenzymes contained about 4 µg protein per ml. The protein contents were determined using the Folin-phenol reagent, and with bovine serum albumen as standard [48]. The eluted GDH hexameric isoenzymes (about 6 mL total volume) were not stored but applied immediately for chimerenomic RNA enzyme synthesis in order to maintain the molar relationships between the redox cycle GDH hexamers and the biological idiosyncrasy of the astrocyte cells used in the extraction of GDH.
2.10.4. Chimerenomic RNA Enzyme Production: The substrate cocktail has already been described [10]; and was prepared by adding the four ribo-NTPs (0.6 mmol each), NH4Cl (100 µmol), α-KG (50 µmol), NADH (0.2 µmol), DNase 1 (1 U), actinomycin D (2 µg), and RNase inhibitor (10 U); the final volume was made up to 1 mL with 0.1 M Tris-HCl buffer solution pH 8.0. The reaction was started by adding 1.0 mL of redox cycle GDH hexameric isoenzyme solution, followed by incubation at 16˚C overnight in the chilled circulating water bath of chimerenomic pump [10]. RNA synthesis was stopped by phenol-chloroform (pH 5.5) extraction of the GDH. RNA was precipitated with ethanol, air-dried briefly, and dissolved in 40 µL of molecular biology quality water, and stored as 5 µL aliquots at -80 0C. RNA synthesis was carried out in duplicate to verify reproducibility of the yields. The whole-gel purified GDH isoenzymes contained about 4 µg protein per ml. The protein contents were determined using the Folin-phenol reagent, and with bovine serum albumen as standard [48].
2.10.5. Chimerenomic RNA Sequencing: The RNAs were custom sequenced by CD Genomics, New York, USA.
3.0. Results and Discussion
3.1. Macromolecular NTinti Chimerenomic RNA Enzymes: The chimerenomic RNA enzymes that were chigrammed by the redox cycle GDH hexameric isoenzymes of the Control human astrocyte cells, and astrocyte cells treated with 1.1 mM, 0.27 mM, 0.137 mM morphine concentrations are in the AAPCR Data File numbers 1 to 4, and 9 to 20 (refer to the Appendix 1 for explanation of terminologies; and to Appendix 2 for the nucleotide sequences of the macromolecular NTinti RNA enzymes.
3.1.1. File ID numbers CHC001 and CHC002 (Control A): The macromolecular NTinti chimerenomic RNA enzymes that were chigrammed by the redox cycle GDH hexameric isoenzymes of the Control A astrocyte cells at confluency are two NTintis File ID numbers CHCOO1 and CHCOO2, each of which was 31,670,251 chimerenomic enzymes, and each of which was about 150 nucleotides long to give a total of 63,340,302 chimerenomic RNA enzyme yield.
3.1.2. File ID numbers CHC003 and CHC004 (Control B): The macromolecular NTinti chimerenomic RNA enzymes that were chigrammed by the redox cycle GDH hexameric isoenzymes of the Control B astrocyte cells at post confluency are two NTintis File ID numbers CHCOO3 and CHCOO4, each of which was 35,534,202 chimerenomic enzymes, and each enzyme being about 150 nucleotides long to give a total of 71,068,404 chimerenomic RNA enzyme yield.
3.1.3. File ID numbers CHC009 and CHC010 (1.1 mM morphine (A): The macromolecular NTinti chimerenomic RNA enzymes that were chigrammed by the redox cycle GDH hexameric isoenzymes of the 1.1 mM morphine-treated astrocyte cells Group A at confluency are two NTintis File ID numbers CHCOO9 and CHCO10, each of which was 32,121,517 chimerenomic enzymes, and each of which was about 150 nucleotides long to give a total of 64,243,034 chimerenomic RNA enzyme yield.
3.1.4. File ID numbers CHC011 and CHC012 (1.1 mM morphine (B): The macromolecular NTinti chimerenomic RNA enzymes that were chigrammed by the redox cycle GDH hexameric isoenzymes of the 1.1 mM morphine-treated astrocyte cells Group B at post-confluency are two NTintis File ID numbers CHCO11 and CHCO12, each of which was 24,000,387 chimerenomic enzymes, and each of which was 150 nucleotides long to give a total of 48,000,774 chimerenomic RNA enzyme yield.
3.1.5. File ID numbers CHC013 and CHC014 (0.27 mM morphine (A): The macromolecular NTinti chimerenomic RNA enzymes that were chigrammed by the redox cycle GDH hexameric isoenzymes of the 0.27 mM morphine-treated astrocyte cells Group A at confluency are two NTintis File ID numbers CHCO13 and CHCO14, each of which was 38,555,342 chimerenomic enzymes, and each of which was 150 nucleotides long to give a total of 77,110,684 chimerenomic RNA enzyme yield.
3.1.6. File ID numbers CHC015 and CHC016 (0.27 mM morphine (B): The macromolecular NTinti chimerenomic RNA enzymes that were chigrammed by the redox cycle GDH hexameric isoenzymes of the 0.27 mM morphine-treated astrocyte cells Group B at post-confluency are two NTintis File ID numbers CHCO15 and CHCO16, each of which was 31,365,308 chimerenomic enzymes, and each of which was 150 nucleotides long to give a total of 62,730,608 chimerenomic RNA enzyme yield.
3.1.7. File ID numbers CHC017 and CHC018 (0.137 mM morphine (A): The macromolecular NTinti chimerenomic RNA enzymes that were chigrammed by the redox cycle GDH hexameric isoenzymes of the 0.137 mM morphine-treated astrocyte cells Group A at confluency are two NTintis File ID numbers CHCO17 and CHCO18, each of which was 37,522,825 chimerenomic enzymes, and each of which was 150 nucleotides long to give a total of 75,045,650 chimerenomic RNA enzyme yield.
3.1.8. File ID numbers CHC019 and CHC020 (0.137 mM morphine (B): The macromolecular NTinti chimerenomic RNA enzymes that were chigrammed by the redox cycle GDH hexameric isoenzymes of the 0.137 mM morphine-treated astrocyte cells Group B at post-confluency are two NTintis File ID numbers CHC019 and CHC020, each of which was 31,707,353 chimerenomic enzymes, and each of which was 150 nucleotides long to give a total of 63,414,706 chimerenomic RNA enzyme yield.
The human brain transcriptome contains about 32,802 transcripts, each being about 2,770 nucleotides long [13]. The above characteristics, which now permit a comparison of the size of the human transcriptome with the multimillion sizes of the morphine-treated human astrocyte chimerenomic NTinti RNA enzymes show that the transcriptome is merely about 0.8% the size of the NTinti RNA enzymes. Herein lies the ability of chimerenomic RNA enzyme activity to spontaneously degrade all mutated, malfunctional, alternatively spliced superfluous total RNA (mRNA, tRNA, rRNA, micro-RNA etc), to reset their abundances, and to reprogram biological processes in the cells, tissues, and whole organism [35].
3.2.0. Chimerenomic Graphical Projections of Opioid Misuse and Overdose Disorders
The above characteristics of the product macromolecular chimerenomic NTinti RNA enzymes chigrammed by morphine-treated astrocyte cell redox cycle GDH are the most appropriate molecular beacons for revealing the inexplicable biological phenomena of opioid intoxication and opioid addiction syndromes. The rigorous chimerenomic research approach is based on the cris-crossing quadrilateral parallelograms of controls that buttress and reinforce all experimental data in the vertical and horizontal domains (Figures 4 to 6) thus illuminating all the chemical reactions at the sub-cellular hierarchy of life. The mono-dimensional triplicating dogma in cell biology has been demonstrated to be inferior to the multi-dimensional cris-crossing chimerenomic parallelogram of controls in its deep illumination of hitherto inexplicable phenomena in biology [16].
3.2.1. Feeling of Euphoria Caused by 0.137 mM morphine: The transition from control astrocytes without morphine treatment to the 0.137 mM morphine treatment was dramatically graphical (Figure 1) in that the activities of the redox GDH in the control confluence astrocytes (63,340,502 chimeres) was inverted and it increased by 30% going to 0.137 mM morphine-treated astrocytes (75,045,650 chimeres); whereas the activities of redox GDH in the control post confluence astrocytes (71,068,404 chimeres) was inverted and decreased (63,414,706 chimeres) by 25% going to the 0.137 mM morphine-treated astrocytes at post confluence. Therefore, as miniscule an amount as 0.137 mM morphine created an inflexion point in the opioid chimerenomic chemistry of the astrocytes. We defined this inflexion point as the morphine threshold of euphoria (feeling good); and it agreed with the GIDP Figure 1. Chimerenomics is a tool for measuring euphoria in molecular language; and it is triggered by 0.137 mM morphine concentration.
|
Legend to Figure 1: Chimerenomic Graphical Projections of Opioid Feeling of Euphoria Disorders Transition from Control astrocytes Group A (confluence) without morphine treatment to the 0.137 mM morphine treatment was dramatically graphic in that the chimerenomic activity of the redox GDH in the Control confluence (Group A) astrocytes was 63,340,502 chimeres and it increased to 75,045,650 chimeres in the 0.137 mM morphine-treated astrocytes (Group A); whereas the activity of the redox GDH in the control post confluence astrocytes (Group B) was 71,068,404 chimeres and it decreased to 63,414,706 chimeres going to the 0.137 mM morphine-treated astrocytes at post confluence (Group B), according to the quadrilateral system of two Group A controls at confluence, and two Group B controls at post confluence of the chimerenomic experimental astrocyte cell research protocol. Therefore, feeling of aggrandizement (euphoria) is a state of morphine-related disorder |
3.2.2. Onset of Opioid Intoxication Caused by 0.27 mM morphine: The transition from the control astrocytes without morphine treatment to the 0.27 mM morphine treatment was more dramatic, more graphical, and very tectonic-like (Figure 2) in that the activities of the redox GDH in the control confluence astrocytes (63,340,502 chimeres) was inverted and increased optimally by 40% going to 0.27 mM morphine-treated astrocytes (77,110,684 chimeres); whereas the activities of redox GDH in the control post confluence astrocytes (71,068,404 chimeres) inverted and decreased (62,730,608 chimeres) by 25% going to the 0.27 mM morphine-treated astrocytes. Therefore, increasing the misuse from 0.137 mM to 0.27 mM morphine created a second and more detrimental inflexion point in the opioid chimerenomic chemistry of the astrocytes. We defined this tectonic-like inflexion threshold as the morphine’s red flag alert for the onset of intoxication. Chimerenomics is a tool for measuring the progression of drug addiction in graphical language; and opioid intoxication is triggered by 0.27 mM morphine concentration.
|
Legend to Figure 2: Chimerenomic Graphical Projections of Opioid Intoxication: Transition from the control astrocytes without morphine treatment to the 0.27 mM morphine treatment was very tectonic-like in that the activity of the redox GDH in the control confluence astrocytes (Group A) was 63,340,502 chimeres, and it became inverted and increased optimally to 77,110,684 chimeres going to 0.27 mM morphine-treated astrocytes (Group A); whereas the activity of redox GDH in the control post confluence astrocytes (Group B) was 71,068,404 chimeres, and it decreased to 62,730,608 chimeres going to the post confluence 0.27 mM morphine-treated astrocytes (Group B). Therefore, increasing morphine misuse from 0.137 mM to 0.27 mM morphine created a second and more detrimental inflexion threshold in the opioid chimerenomic chemistry of the astrocytes. We defined this tectonic-like inflexion threshold as the morphine’s red flag alert for the onset of intoxication; according to the quadrilateral system of two controls at astrocyte confluence, and two controls at astrocyte post confluence of the chimerenomic experimental astrocyte cell research protocols. |
3.2.3. Full-Blown Opioid Addiction Caused by 1.1 mM morphine: Opioid overdose (Figure 3) from the control astrocytes redox cycle GDH activity (71,068, 404 chimeres) at post confluence decreased to a precipitous 33% low level in the redox cycle GDH activity (48,000,774 chimeres) of 1.1 mM morphine-treated astrocyte at post confluence was the molecular evidence that full-blown opioid addiction causes death. Based on their chemical structures, strong opioids include morphine, pethidine, pentazocine, papaveretum, oxycodone, methadone, hydromorphone, fentanyl, dipipanone, buprenorphine, and heroin.
|
Legend to Figure 3: Chimerenomic Graphical Projections of Full-Blown Opioid Overdose Addiction: Opioid overdose from the Control (no morphine) astrocytes redox cycle GDH activity (71,068, 404 chimeres) at post confluence (Control Group B) to a precipitous 33% decline in the redox cycle GDH activity (48,000,774 chimeres) of 1.1 mM morphine-treated astrocyte at post confluency (Group B) was the molecular evidence that full-blown opioid addiction causes death according to the quadrilateral system of two Group A controls at confluence, and two Group B controls at post confluence of the chimerenomic experimental astrocyte cell research protocols. |
3.3.0 AAPCR functional chimerenomic bioinformatics analysis tool applied to characterize opioid misuse and overdose disorders: The functional chimerenomic bioinformatics analysis tool was developed also for the determination of sequence alignments by which homologous superfluous/dysfunctional human mRNAs, rRNAs, transfer RNAs, long noncoding RNAs etc are degraded by chimerenomic macromolecular NTinti RNA enzymes chigrammed by human astrocyte redox cycle GDH.
3.3.1. mRNAs Encoding Superfluous Proteins of the Opioid Misuse and Overdose Disorders: The function of chimerenomic RNA enzymes is to degrade superfluous homologous mRNAs, rRNAs, tRNAs etc so that they are not translated [15; 39]. Using the chimerenomic sequence homology analysis tool and the AAPCR macromolecular chimerenomic RNA enzymes sequences (refer to Table 2) chigrammed by morphine-treated astrocytes redox GDH Data File ID Numbers: CHC001, CHC002, CHC003, CHC004, CHC009, CHC010, CHC011, CHC012, CHC013, CHC014, CHC015, CHC016, CHC017, CHC018, CHC019, and CHC020 as subjects (Table 2), and the human mRNA sequences encoding the superfluous proteins as queries (Table 1) showed that all the morphine-related macromolecular chimerenomic RNA enzymes produced mRNA degradation matches with all the mRNAs encoding the superfluous proteins of opioid addiction.
Aberrant, mutated, alternatively spliced, and variant isoforms of mRNAs that encode the superfluous proteins of opioid misuse and overdose disorders include GenBank accession number X87838.1 for β-catenin; GenBank accession number ENAAY490254 for p120-glycoprotein adherens junction complex; GenBank accession number AF115266 for G-protein coupled opioid receptor; GenBank accession number GQ478709 for mu-opioid receptor; GenBank accession number U11053 for kappa-opioid receptor; GenBank accession number U07882 for delta-opioid receptor; GenBank accession number U07747 for mitogen activated protein kinase; GenBank accession number AF145711 for Ca/Calmodulin-dependent protein kinase 11; GenBank accession number X14968 for cyclic AMP-dependent protein kinase G; GenBank accession number X58633 for glutamate ionotropic receptor; GenBank accession number AJ236921 for glutamate metabotropic receptor; GenBank accession number BC030696 for GABA receptor; GenBank accession number AY136750 for dopamine receptor; GenBank accession number AJ003080 for serotonin; GenBank accession number AY036912 for lipase H membrane phospholipase A1-alpha; GenBank accession number AF182276 for cytochrome P450 monooxygenase; GenBank accession number X02317 for Cu/Zn superoxide dismutase; GenBank accession number D00741 encoding alternative oxidase; GenBank accession number Y13047 encoding glutathione S-transferase; GenBank accession number AF103796 for ABC transporter; GenBank accession number M38297 for endorphin; GenBank accession number BC032505 for enkephalin receptors; GenBank accession number AH006533 for synapsin (Table 1).
Dysregulation of the opioid signaling pathways by the above-listed superfluous proteins accounts for some of the root causes of opioid misuse and overdose disorders, as discussed hereunder.
Table 1: GenBank accession numbers of mRNAs that are homologous to chimerenomic macromolecular NTinti RNA enzymes of Astrocyte cells treated with Morphine concentrations.
|
Serial Nos |
GenBank Accession Nos |
Encoding human mRNA |
|
|
Table 2: Showing the first lines of Synthesized Chimerenomic Non Genetic Code-base RNA Sequences for Control and Morphine Concentration, at Pre and Post Confluence Experimental Stages
|
API (mM) |
Data Set |
First line of sequence out of the total millions of lines of sequences as shown
|
|
Control A |
CHC001 |
CNCCAGGCGGTCAACTTAATGCGTTAGCTGCGCCACTAAAAGCTCAAGGCTTCCAACGGCTAGTTGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTCAGTGTCAGTATTAGTCCAG. 1 of 31,670,251 unique lines of sequences
|
|
|
CHC002 |
GAAGGCGACCACCTGGACTAATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCAACTAGCCGTTGGAAGCCTTGAGCTTTTAGTGGCGCAGCTAACGCATTAAGTT. 1 of 31,670,251 unique lines of sequences
|
|
Control B |
CHC003 |
NTTCCCTTTTCACGACGGACGTTAGCACCCGCCGTGTGTCTCCCAGGCTCGGCACTTGTCGGTATTAGGAGTTTGCATCGGTTTGGTAAGTCGGGCTGACCCCCTAGCCGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGCT. 1 of 35,534,202 unique lines of sequences
|
|
|
CHC004 |
CGGCTAGGGGGTCATCCCGACTTACCAAACCGATGCAAACTCCGAATACCTACAAGTGCCGAGCATGGGAGACACACGGCGGGTGCTAACGTCCGTCGTGAAAAGGGAAAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTA. 1 of 35,534,202 unique lines of sequences
|
|
Morphine 1.1 mM gpA |
CHC009 |
CCCGTTACATCTTCCGCGCAGGCCGACTCGACTAGTGAGCTATTACGCTTTCTTTAAAGGGTGGCTGCTTCTAAGCCAACCTCCTAGCTGTCTAAGCCTTCCCACATCGTTTCCCACTTAACCATAACTTTGGGACCTTAGCTGACGGTC. 1 of 32,121,517 unique lines of sequences
|
|
|
CHC010 |
CCCGACTTACCAAACCGATGCAAACTCCGAATACCTACAAGTGCCGAGCATGGGAGACACACGGCGGGTGCTAACGTCCGTCGTGAAAAGGGAAACAACCCAGACCGTCAGCTAAGGTCCCAAAGTTATGGTTAAGTGGGAAACGATGTG. 1 of 32,121,517 unique lines of sequences
|
|
Morphine 1.1 mM gpB |
CHC011 |
GTTCAGGCGGCCCAGGTCCAGCGGCGCAAACGTGCCGTCAGCCAGGGTGATACGGATCGAGGGGTGAGCTTGCACGGCCGCTTCTTCAGCCGGGGTGCGTACGGCGCGTTACTTGGAACGGGCGTCACGGTAGATCACGTAGTCGCGCGC. 1 of 24,000,387 unique lines of sequences
|
|
|
CHC012 |
CACCTGGCCAATTGCGCGTGATCAAGCGTAACGGCACTGTCGTTCCTTACACCGATGACAAAATCACCGTCGCCATCACCAAAGCGTTTCTTGCAGTTGAAGGCGGCACCGCTGCTGCCTCGTCGCGCATCCACGACACCGTTGCCCGCC. 1 of 24,000,387 unique lines of sequences
|
|
Morphine 0.27 mM gpA |
CHC013 |
NCCCAGGCGGTCAACTTAATGCGTTAGCTGCGCCACTAAAAGCTCAAGGCTTCCAACGGCTAGTTGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTCAGTGTCAGTATTAGTCCAG. 1 of 38,555,342 unique lines of sequences
|
|
|
CHC014 |
AAGGCGACCACCTGGACTAATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCAACTAGCCGTTGGAAGCCTTGAGCTTTTAGTGGCGCAGCTAACGCATTAAGTTG. 1 of 38,555,342 unique lines of sequences
|
|
Morphine 0.27 mM gpB |
CHC015 |
CNTGGTATTCTCTACCCAACCACCTGTGTCGGTTTGGGGTACGGTTCCTGGTTACCTGAAGCTTAGAAGCTTTTCTTGGAAGCATGGCATCAACCACTTCGTTAACTAAAAGTTAACTCGTCATCAGCTCTCGGCCTTGAAATCCCGGAT. 1 of 31,365,304 unique lines of sequences
|
|
|
CHC016 |
TGGTTGTCCAAGTTTAAGGTGGTAGGCTGAAATCTTAGGTAAATCCGGGATTTCAAGGCCGAGAGCTGATGACGAGTTAACTTTTAGTTAACGAAGTGGTTGATGCCATGCTTCCAAGAAAAGCTTCTAAGCTTCAGGTAACCAGGAACC. 1 of 31,365,304 unique lines of sequences
|
|
Morphine 0.137mM gpA |
CHC017 |
NCTCCCCACGCTTTCGCACCTCAGTGTCAGTATTAGTCCAGGTGGTCGCCTTCGCCACTGGTGTTCCTTCCTATATCTACGCATTTCACCGCTACACAGGAAATTCCACCACCCTCTACCATACTCTAGTCAGTCAGATTTGAATGCAGT. 1 of 37,522,825 unique lines of sequences
|
|
|
CHC018 |
GTGGTTTGTTAACTTGGATGTGAAATCCCCGGGCTCAACATGGGAACTGCATTCAAAACTGACTGACTAGAGGATGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGCAAGGAACACCAGTGGCGAAGGCGA. 1 of 37,522,825 unique lines of sequences
|
|
Morphine 0.137 mM gpB |
CHC019 |
GNCCCTTCAGGGAACTCAAGGTTCCAGTGAGATCTCATCTTGAGGCTAGTTTCCCGCTTAGATGCTTTCAGCGGTTATCTATTCCGAACATAGCTACCCGGCAATGCCACTGGCGTGACAACCGGAACACCAGAGGTTCGTCCACTCCGG. 1 of 31,702,353 unique lines of sequences
|
|
|
CHC020 |
GGCTGCTCCTAGTACGAGAGGACCGGAGTGGACGAACCTCTGGTGTTCCGGTTGTCACGCCAGTGGCATTGCCGGGTAGCTATGTTCGGAATAGATAACCGCTGAAAGCATCTAAGCGGGACACTAGCCTCAAGATGAGATCTCACTGGA. 1 of 31,702,353 unique lines of sequences |
Group A represents Pre-confluence, Group B represents Post-confluence, API (Active Pharmacological Ingredients). Full data is available at www.chimerenomics.com
3.3.2. Disorders Related to Variant mRNAs Encoding Malfunctional Proteins of Opioid Overdose Disorders:
The blood-brain barrier: The mechanism by which opioids induce aggrandizement (euphoria) and relieve pain depends on the drug crossing the blood-brain barrier and accessing the central nervous system [49]. The blood–brain barrier (BBB) serves as a dynamic and selective interface separating the central nervous system (CNS) from the periphery. Homeostasis within the CNS is maintained via coordination of physical, metabolic and transport-mediated mechanisms that carefully control the counter-directional transport of nutrients and waste products from the brain. The key junctional plaque proteins that constitute the BBB include catenins and P-glycoprotein. They serve protective functions to actively export a wide array of structurally diverse endogenous and exogenous substrates into the periphery. However, the human genes encoding catenin and p120-glycoprotein-adherens junction complexes are alternatively spliced. The variant mRNAs assume aberrant conformations; become translated to misfolded proteins that fail to perform their natural protective functions in the blood-brain barrier.
Accordingly, chimerenomic chemistry and medicine have focused increasing attention by demonstrating the potential for degrading the alternatively spiced mRNAs for drug addiction therapeutic benefit. Hence, unravelling the regulatory mechanisms of chimerenomic macromolecular RNA enzymes have the potential to enhance the discovery of new drug therapy of addiction.
Morphine binds to delta, kappa, and mu opioid receptors: Mu opioid receptor agonists are on terminal axons of primary afferents in the spinal cord, in the brain and other locations. The human mu opioid receptor gene, OPRM1, produces a multitude of alternatively spliced mRNAs encoding full-length or truncated receptor variants. Most of these mRNAs are transcribed from the main promoter upstream of exon 1, or from alternate promoters associated with exons 11 and 13 [20].
Binding opioid molecules to the natural receptor kappa causes a conformation change that triggers signaling via G proteins and modulates the activity of down-stream effectors, such as adenylate cyclase. Signaling inhibits neurotransmitter release by reducing calcium ion currents and increasing potassium ion conductance thus playing a role in the perception of pain, neuroendocrine physiology, affective behavior, and cognition [19].
We have demonstrated that chimerenomic RNA enzyme chimmerized by the redox GDH from morphine-treated astrocytes shared degradative sequence homologies with the mRNAs for the opioid receptors (Table 1). Like the mu-opioid receptor, delta opioid receptor is G-protein coupled receptor not only for endogenous enkephalins but also for a subset of other opioids. Ligand binding also causes a conformation change that triggers signaling via G proteins and modulates the activity of adenylate cyclase. Signaling leads to the inhibition of adenylate cyclase activity. It inhibits neurotransmitter release by reducing calcium ion currents and increasing potassium ion conductance. It plays a role in the perception of pain and in opiate-mediated analgesia. It plays a role in developing analgesic tolerance to morphine. It is remotely implicated in alcohol dependence; alcohol use disorder; multiple drug dependence; opioid abuse; and withdrawal disorders. So, a cure for delta- and mu-receptor proteins-related malfunctioning using chimerenomic medicine potentially cures a host of other drug-related disorders. Also, as with the other receptors, delta opioid receptor gene is transcriptionally very diverse [50; 51], producing misfolded protein isoforms (GenBank Accession number AY225404). The variant mRNAs assume aberrant conformations; become translated to misfolded proteins that fail to perform their natural protective functions in the CNS.
Accordingly, increasing attention by chimerenomic chemistry and medicine has been cast on the potential for degrading the superfluous alternatively spliced mRNAs for drug addiction therapeutic benefits. Hence, unravelling the regulatory mechanisms of chimerenomic macromolecular RNA enzymes have the potential to enhance the discovery of new drug therapy for addiction.
Protein kinases connect cellular processes by creating signaling pathways: Human protein kinases connect signaling pathways are involved in good health and disease conditions; they transduce, amplify and integrate cellular processes through protein phosphorylation [24; 52]. However, they belong to a single superfamily, characterized by a contiguous stretch of about 250 amino acid residues that constitutes their catalytic site.
In the mutated mRNAs (GenBank U07747) encoding mitogen-activated kinase, the aberrant proteins fail to be phosphorylated [25] thereby creating malfunctional kinase.
We have demonstrated that chimerenomic RNA enzymes chimmerized by the redox GDH from morphine-treated astrocytes shared degradative sequence homologies with the mRNAs for the protein kinases (Table 1).
Calcium/calmodulin-dependent protein kinase functions autonomously after Ca2+/calmodulin-binding and autophosphorylation. It is involved in synaptic plasticity, neurotransmitter release and long-term potentiation of excitatory synapses. The disease of this kinase signaling complex is caused by variations affecting the mRNA (GenBank accession number AF145711.1) [53].
Cyclic AMP-dependent protein kinase type II-alpha regulatory subunits mediate membrane association by binding to anchoring proteins, including the MAP2 kinase. The inactive form of the enzyme is composed of two regulatory chains and two catalytic chains. Activation by cAMP produces two active catalytic monomers and a regulatory dimer that binds four cAMP molecules. The full-length human cDNA corresponding to the mRNA (GenBank accession number X14968.1) contains an alternative amino-terminal region (amino acids 45-75) compared with the native sequences. This alternate region is also present in RII alpha mRNA (7.0 kb) of human somatic cells. The divergent amino-terminal sequence is involved in subcellular mis-attachment of RII alpha and thereby mis-localization of the kinase activity to wrong targets within the cell [54].
In general, although the protein kinases create pathways for the transmission of signals to the CNS, they do not respond in a step-wise manner (pleasure/aggrandizement, intoxication, addiction) to variable molar concentrations of opioids as GDH does (Figs 1-3), to alert biochemical pathways of the build-up of bodily physicochemical pain and harmful substances in the cells.
Accordingly, increasing attention by chimerenomic chemistry and medicine has been cast on the potential for degrading the superfluous alternatively spliced mRNAs including those that have undergone wrong post-transcriptional processing, for drug addiction therapeutic benefits. We have demonstrated that chimerenomic RNA enzyme chigrammed by the redox GDH from morphine-treated astrocytes shared degradative sequence homologies with the mRNAs for the kinases (Table 1). Hence, unravelling the regulatory mechanisms of chimerenomic macromolecular RNA enzymes have the potential to enhance the discovery of new drug therapy for addiction.
Glutamate Receptor 1: The Ionotropic Gate-keeper: Ionotropic glutamate receptor functions as a ligand-gated cation channel, gated by L-glutamate and glutamatergic agonists such as alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), quisqualic acid, and kainic acid. L-glutamate acts as an excitatory neurotransmitter at many synapses in the central nervous system. Binding of the excitatory neurotransmitter L-glutamate induces a conformation change, leading to the opening of the cation channel, and thereby converts the chemical signal to an electrical impulse upon entry of monovalent and divalent cations such as sodium and calcium. The receptor then desensitizes rapidly and enters in a transient inactive state, characterized by the bound agonist. The human mRNA (GenBank Accession number X58633.1) was detected in cerebral cortex, hippocampus and cerebellum [21]. Alternative splicing of the mRNA produces a large number of the receptor variants [55] with potential dysregulated gatekeeping activities that mimic neurodegenerative and addiction disorders.
Glutamate Receptor 8 (Metabotropic): Glutamate binding causes a conformation change that triggers signaling via G proteins and modulates the activity of down-stream effectors, such as adenylate cyclase. Signaling inhibits adenylate cyclase activity [56]. The mRNA (accession number AJ236921) has a multitude of 1203 variants in addition to isoforms produced by alternative splicing [57]. Translation of variant and alternatively spliced isoforms of mRNAs produce misfolded proteins that dysregulate biological processes thus creating addiction, degenerative, inflammatory and other disease conditions.
We have demonstrated that chimerenomic RNA enzyme chigrammed by the redox GDH from morphine-treated astrocytes shared degradative sequence homologies with the mRNAs for the glutamate ionotropic and metabotropic receptors (Table 1). Hence, unravelling the regulatory mechanisms of chimerenomic macromolecular RNA enzymes have the potential to enhance the discovery of new drug therapy for addiction.
Malfunctional and superfluous mRNAs including those resulting from alternative splicing events are degraded spontaneously by chimerenomic macromolecular RNA enzymes.
Gamma-aminobutyric acid (GABA) receptor subunit alpha-1: This is a transmitter-gated monoatomic ion channel activity involved in the regulation of postsynaptic membrane potential. GABA-gated chloride channel is a major inhibitory neurotransmitter in the brain [58]. When activated by GABA, GABAARs selectively allow the flow of chloride anions across the cell membrane down their electrochemical gradient. Conversely, chloride influx into the postsynaptic neuron following GABAAR opening decreases the neuron ability to generate a new action potential, thereby reducing nerve transmission. Disease malfunction of the receptor protein is associated with the production of hundreds of variants affecting the mRNA (accession number BC030696). Because the variant mRNAs share sequence homology with chimerenomic RNA enzymes chigrammed by redox GDH of morphine-treated astrocyte cells, they can now be wiped out with attendant restoration of good health using the chimerenomic RNA enzyme therapy.
Dopamine receptor: Dopamine receptor activity is mediated by G proteins which activate adenylyl cyclase. Disease malfunctioning of the receptor like in other receptors may be associated with the 792 mutational variants affecting the mRNA, GenBank accession number AY136750, which also shares sequence homology with chimerenomic RNA enzymes chigrammed by redox GDH of morphine-treated astrocyte cells, they can now be wiped-out with attendant restoration of good health using the chimerenomic RNA enzyme therapy.
Serotonin receptor: Serotonin receptor forms serotonin (5-hydroxytryptamine/5-HT3)-activated cation-selective channel complexes, which when activated cause fast, depolarizing responses in neurons. There are several of the receptor proteins for serotonin, each of the multiple serotonin receptor protein variants has a unique ID name, and the encoding mRNA has a GenBank accession number, which may be the root cause of the neurological disorders associated with the receptor proteins, accession no. AJ003080 [23].
Catabolic Enzymes in Opioid Addiction: We have similarly demonstrated that chimerenomic RNA enzymes chigrammed by the redox GDH from morphine-treated astrocytes shared degradative sequence homologies with the mRNAs for the drug degrading enzymes (Table 1). When superfluous mRNAs for the drug degrading enzymes are translated to misfolded proteins without degradative activities, they cause dysregulation disease of the metabolism in the addicted:
Lipase member H: Membrane-associated phosphatidic acid-selective phospholipase A1-alpha (mPA-PLA1 alpha) hydrolyzes phosphatidic acid to produce 2-acyl lysophosphatidic acid, a potent bioactive fatty acid and lipid mediator [27]. The disease is caused by variants affecting the gene (GenBank accession number AY03612). It does not hydrolyze phosphatidylserine, phosphatidylcholine phosphatidylethanolamine and triacylglycerol.
Cytochrome P450 monooxygenase degrades fatty acids by inserting one oxygen atom into the substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (NADPH--hemoprotein reductase) [59]. Diseases associated with the malfunction of this enzyme are due to the existence of numerous (more than775) isoforms and variants showing features for mutagenesis, and natural variations, thus being a candidate disorder to be treated by the chimerenomic macromolecular RNA enzyme homologous sequence degradation of the superfluous mRNA.
Cu/Zn Superoxide dismutase: It destroys free radicals which are normally produced within the cells, and which are toxic to biological systems. Amyotrophic lateral sclerosis 1 (ALS1) is the disease caused by variants affecting the gene (GenBank Accession number X02317). The dysfunctional proteins (both wild-type and ALS1 variants) tend to form fibrillar aggregates in the absence of the intramolecular disulfide bond or of bound zinc ions. These aggregates have cytotoxic effects [60]. ALS disorder affects motor neurons in the brain, brain stem, and spinal cord. The pathologic hallmarks of the disease include pain of the corticospinal tract due to loss of motor neurons, and deposition of pathologic aggregates. The ramifications of the dysregulated superoxide dismutase proteins being deposited on motor neurons directly implicate the encoding mRNAs as superfluous transcripts thus qualifying them as candidates for spontaneous chimerenomic macromolecular RNA enzyme degradation therapy.
Alternative Oxidase: catalyzes cyanide-resistant oxygen consumption [29; 61].
Glutathione S-transferase: conjugates reduced glutathione to hydrophobic molecules of drugs. Dysregulation and disease of the glutathione S-transferase proteins is due to mutagenesis of the natural variant transcripts, GenBank accession number Y13047 [62].
ABC Transporter: ATP-binding cassette transporter. We have demonstrated that chimerenomic RNA enzyme chigrammed by the redox GDH from morphine-treated astrocytes shared degradative sequence homologies with the mRNAs for the ABC transporter (Table 1). The transporter protein actively extrudes a wide variety of the degradation products of drugs, steroids, catabolites of chlorophyll, dietary toxins and xenobiotics from mitochondria to cytosol and cytosol to extracellular space [31]. It plays an important role in the exclusion of xenobiotics from the brain. In placenta, it limits the penetration of drugs from the maternal plasma into the fetus. Diseaces related to the dysregulation of ABC transporter are caused by the mutagenesis of the gene, GenBank accession number AF103796, and by the existence of multifamily of natural variants whose mRNAs appear as superfluous transcripts waiting to be degraded by therapeutic chimerenomic macromolecular RNA enzymes.
Endorphins: Endorphins are naturally produced opioid neuropeptides that act as both neurotransmitters and hormones. Their primary function is to block pain perception and promote feelings of pleasure and well-being [63]. The mRNA sequences for human endorphin proteins, β-endorphin, are associated with the Pro-opiomelanocortin (POMC) pain relieving function of endorphin. This gene encodes a larger precursor protein from which multiple peptide products are derived, including β-endorphin. The multiplicity of the polypeptide products gives an appearance of dysregulation to the transcripts, a precondition for their degradation by chimerenomic macromolecular RNA enzymes.
Proenkephalin A receptor: The human enkephalin receptors, including the delta-type opioid receptor (OPRD1) and the opioid growth factor receptor (OGFR), are G-protein coupled receptors that bind enkephalins (endogenous opioid peptides). The ID for receptor P41143 is OPRD1 and Q9NZT2 is OGFR. The mRNA encodes for the precursor protein called proenkephalin (PENK), which is then processed into the active enkephalin peptides, including Met-enkephalin and Leu-enkephalin. The mechanisms are delineated according to the sub-types: Met-enkephalin, and Leu-enkephalin: Neuropeptide that competes with and mimic the effects of opiate drugs. They play a role in a number of physiologic functions, including pain perception and responses to stress.
Met-enkephalin-Arg-Phe: Neuropeptide acts as a strong ligand of Mu-type opioid receptor OPRM1. Met-enkephalin-Arg-Phe-binding to OPRM1 in the nucleus accumbens of the brain increases activation of OPRM1, leading to long-term synaptic depression of glutamate release.
PENK(114-133): Increases glutamate release in the striatum and decreases GABA concentration in the striatum.
PENK(237-258): Increases glutamate release in the striatum.
Disease and Variants of mRNA GenBank accession number BC032505 show features for 471 natural variants that share sequence homologies with chimerenomic RNA enzymes.
Synapsin-1 receptor: Synapsin receptor is involved in the control of neurotransmitter release at the pre-synaptic terminal. The diseases are caused by alternatively spliced mRNA variants affecting the gene: GenBank accession number AH006533 [22].
3.4.0. Therapy of Opioid Addiction: Where are the active ingredients for the prevention and treatment of opioid addiction?
3.7.1. The macromolecular chimerenomic RNA enzymes of the post confluence astrocytes: A comparison in the vertical logic of the chimerenomic sciences going from the macromolecular NTinti RNA enzymes chigrammed by post confluence astrocyte redox GDHs (Figures 4 to 6), the aggrandizement disorder caused by 0.135 mM morphine will be cured by therapeutic ingredients containing the NTinti RNA enzymes chigrammed by the 0.135 mM morphine-induced redox GDH; the intoxication disorder caused by 0.27 mM morphine will be cured by therapeutic ingredients containing the NTinti RNA enzymes chigrammed by the 0.27 mM morphine-induced redox GDH; and the morphine addiction disorder caused by 1.1 mM morphine will be cured by therapeutic admixtures containing the NTinti RNA enzymes chigrammed by the 1.1 mM morphine-induced redox GDH. The toxic range is up to 1.5 mM morphine. Our research protocol (Figures 1 to 3, and Appendix 2) for understanding the dangers of opioid misuse and overdose including treatment and prevention of addiction is applicable to other drugs of abuse and chemical substances.
Wherefore, the therapeutic fail-proof efficacy of macromolecular chimerenomic RNA enzyme (NTinti) medications to prevent the dysregulation of and to treat malfunctional opioid addiction pathways is derived from the universality of GDH signaling mechanisms in humans, and foods.
4.0. General Discussion
4.1 Opioid-NTinti Chimerenomic RNA Enzymes for Cure of Opioid Addiction:The neural projection pathways from the ventral tegmental area (VTA) [64], the pathways for peripheral pain and temperature sensations leading to the thalamus [65], the drug metabolism routes originating in the liver [26], the addiction-related neurotransmitter pathways [66, 67], and the intracellular kinase systems all play significant roles in addiction and substance use disorder (SUD) [64]. All these systems are also treatment targets for Opioid-NTinti chimerenomic RNA enzyme medications. In the absence of Opioid-NTinti treatment, these systems operate concurrently, the impacted cells activate a corrective mechanism that captures every alteration in temporal homeostasis. This is achieved through the electromagnetic and electrochemical translation of various events into a distinct type of RNA that is not based on the genetic code. These non-code-based RNAs are referred to as chimerenomic RNA [10. The chimerenomic RNA system is regulated by NADH-GDH isoenzymes, initiating a response to changes in the homeostatic environment and forming complexes with any specific addictive substance, such as morphine. This NADH-GDH corrective system functions as an inherent natural adaptation mechanism, aimed at restoring homeostasis disrupted by the addiction cascade. This concept has been a long-sought element in addiction science; the existence of this parallel cellular system that regulates the expression of distortions inflicted on genetic codes by both internal and external factors represents a groundbreaking advancement in the field of addiction research, now presented for the first time here.
This study investigates the impact of morphine on human astrocyte cells, aiming to clarify this discovery, demonstrate its efficacy, and explore its potential for developing effective treatments for addiction and SUD. Below, we outline the established and proposed biological mechanisms underlying addiction based on current understanding.
4.2 Anatomy of brain neural projections for addiction
4.2.1 Various neural projections originating from the brainstem and midbrain have been linked to addiction and movement disorders. Notably, two projections from the ventral tegmental area (VTA)—the mesocortical and mesolimbic pathways—are particularly associated with substance use disorder (SUD) and addiction. The mesocortical projections extend from the VTA to the prefrontal cortex, which plays a crucial role in the conscious regulation of motivation, emotion, and control of voluntary movement. In contrast, the mesolimbic system connects the VTA to several key areas, including the nucleus accumbens (NA), olfactory bulb, amygdala, limbic system, caudate nucleus, putamen in the corpus striatum, and the hypothalamic-hypophyseal axis. This mesolimbic system is integral to the experience of euphoria, the reward and pleasure response, mood regulation, sleep, and more. The VTA is composed of approximately 60% dopamine neurons, 30% GABA neurons, and 10% glutamate neurons [66; 67].
Both endogenous and exogenous opioid receptor agonists stimulate dopamine release while inhibiting the release of GABA and glutamate. Additionally, beta-endorphins are produced in the hypothalamo-pituitary tracts and diffuse throughout the brain and the body [68].
4.2.2 Peripheral nerves: are extensively distributed throughout the body and its tissues. Proprioceptive and tactile signals are transmitted from these nerves to the dorsal root ganglion, then to the nucleus gracilis and cuneatus in the spinal medulla. From there, second-order neurons cross to the contralateral side and project via the medial lemniscal pathway to the thalamus. The spinothalamic tract, which consists of peripheral nerves responsible for pain and temperature sensation, transmits signals to the dorsal root, then to the spinal nucleus. Second-order neurons subsequently cross to the contralateral side and ascend as the lateral spinothalamic tracts through the spinal cord to the thalamus [69; 70]. In response to nociceptive stimuli, these peripheral nerves release substance P. Opioid receptor agonists, such as morphine, bind to mu receptors on the presynaptic membranes of peripheral nerves, inhibiting the release of substance P and thereby diminishing the transmission of pain sensations [65].
4.3 Cells Involved in Addiction
Neurons are essential for neurotransmission, facilitating the delivery of neurotransmitters across various brain circuits and projections [70]. In contrast, astrocytes significantly contribute to neural plasticity, adaptation, and learning—key processes that are integral to the addiction cascade.
Astrocytes are likely key players in the long-lasting excitatory plasticity that develops within the corticostriatal circuitry as a result of chronic drug use. Their processes are strategically located near excitatory synapses, and the expression of neurotransmitter transporters on astrocytes helps regulate the stimulation of both pre- and postsynaptic receptors. Additionally, astroglia can directly communicate with synapses through the release of transmitters, playing a crucial role in the homeostatic regulation of synaptic function. [71]
Hepatocytes are the main liver cells responsible for metabolizing a wide range of substances, including drugs associated with addiction (refer to sections 1.10 and 3.6.2).
This new opioid-NTinti chimerenomic RNA drugs targets all these cell types.
4.4 Addiction Drug Metabolism
For drugs such as morphine to exert their effects, they must undergo a series of processes: absorption, distribution, metabolism, and excretion. These steps are essential for achieving an adequate plasma concentration of the drug and for traversing biological membranes, such as the blood-brain barrier, to access the brain. For instance, the ABC transporter family of enzymes is responsible for expelling drugs from cells and the brain, while the cytochrome P450 enzyme system, which comprises over 775 isoforms, plays a critical role in various drug metabolism and detoxification processes (see section 1.10 for further details). All these factors contribute to the overall addiction risks associated with opioids like morphine. Currently, no addiction treatments have adequately considered these aspects of drug metabolism. However, with the introduction of chimerenomic RNA, many of the abnormal RNAs generated through alternative splicing can be degraded, thereby restoring normal enzyme function and addressing the inefficiencies and errors in current drug metabolism and treatment [26].
4.5.0 Addiction and Pain Pathways for Receptors and Neurotransmitters
The study of addiction involves various receptors, including but not limited to opioid receptors (mu, delta, and kappa), dopamine, GABA, glutamate, substance P, NMDA, AMPA, neuropeptides, neurotensin, and others. The intracellular effects and changes that occur when drugs interact with these receptors can be extensive and long-lasting. Many drugs penetrate cells and bind to various enzymes, causing physicochemical alterations that disrupt cellular homeostasis. Due to the stress these changes impose on cellular physiology, excess superfluous mRNAs are frequently produced due to alterative splicing [70].
When morphine binds to mu opioid receptors, it affects both peripheral nervous system (PNS) and central nervous system (CNS) cells differently. In the PNS morphine binds to mu receptors and inhibits the release of substance P and in so doing prevent pain impulse transmission; while in the CNS morphine binds to mu receptors and inhibits the release of GABA and glutamate. By inhibiting GABA, an inhibitory neurotransmitter of dopamine releasing neurons, the resultant effect if the release of more dopamine. The release of dopamine from the VTA leads to dopamine release in the neural projections in the mesocortical (frontal cortex) and the mesolimbic projections (nucleus acumbens, amygdala, limbic system, etc) [72; 73].
4.5.1 Feedback Loop: Initially, there may be a relative increase in circulating endorphins, followed by a decrease in the synthesis of both endorphins and mu receptors. As the number of mu receptors declines, progressively higher doses of morphine are required to stimulate dopamine release for adequate reward maintenance, leading to the development of tolerance. At the same time, cells start producing several proteins collectively called "addiction proteins". Numerous proteins, including anti-opioid peptides like CCK, nociceptin/orphanin FQ, neuropeptide FF, and others, act to reduce the impact of opioids on their receptors. This limitation contributes to the formation of opioid tolerance and addiction [74].
The feedback loop established by the inhibition of GABA and glutamate receptors results in increased intracellular production of GABA and glutamate, which further diminishes dopamine release and reduces the sense of reward. This cycle amplifies the interaction between addiction receptors and neurotransmitters, perpetuating the addiction process as well. Opioid-NTinti RNA medicines inhibit these feedback loops resulting from the addiction cascade.
4.6 Intracellular Kinase Pathways
Human protein kinases play a crucial role in connecting signaling pathways that are essential for maintaining good health and addressing disease conditions. They transduce, amplify, and integrate cellular processes involved in opioid addiction through the mechanism of protein phosphorylation [24; 52]. Protein kinases belong to a single superfamily, characterized by a continuous stretch of approximately 250 amino acid residues that form their catalytic site. During the stress induced by opioid addiction pathways, kinase synthesis can undergo mutations, resulting in the production of aberrant proteins that are unable to be phosphorylated [25], leading to dysfunctional kinases.
Calcium/calmodulin-dependent protein kinase operates autonomously following Ca²⁺/calmodulin binding and autophosphorylation. This kinase is involved in synaptic plasticity, neurotransmitter release, and the long-term potentiation of excitatory synapses. Additionally, cyclic AMP-dependent protein kinase type II-alpha regulatory subunits facilitate membrane association by binding to anchoring proteins, including MAP2 kinase. The inactive form of this enzyme consists of two regulatory chains and two catalytic chains. When activated by cAMP, it produces two active catalytic monomers and a regulatory dimer that binds four cAMP molecules.
This study has shown that chimerenomic RNA enzymes, chimmerized by the redox GDH from morphine-treated astrocytes, exhibit degradative sequence homologies with the mRNAs encoding protein kinases (see Table 1).
4.7 NADH-GDH Chimerenomic Correction System
One of the most significant counter and parallel components of the addiction pathways, hitherto hidden, is the NADH-GDH hexameric isoenzyme complex correction system. This system not only records all electromagnetic and electrochemical changes occurring within cells at various levels but also generates rapid, non-genetic code-based RNAs aimed at restoring cellular homeostasis. It operates as a parallel system to the previously described addiction pathways but impeded in vivo by many cellular inhibitory factors. While addiction pathways mentioned previously initiate a cascade of events following morphine's binding to receptors (such as the mu receptor), creating feedback loops that prompt cells to produce addiction proteins, receptors, secondary messengers, and neurotransmitters through the upregulation of genetic code-based RNA production, the NADH-GDH chimerenomic righting (correction) system functions independently and oppositely.
The NADH-GDH chimerenomic righting system operates in two primary ways. First, it begins by sensing electromagnetic changes in the environment (indicating altered homeostasis) through the glutamate dehydrogenase isoenzyme complex, which shifts the equilibrium of the alpha-ketoglutarate to glutamate reaction in favor of glutamate synthesis, leading to glutamate accumulation within the cells.
The second event involves the interaction of morphine, a nucleophile, with the NADH-GDH hexameric isoenzyme complex, resulting in the formation of Schiff base complexes. The isomerization of GDH is triggered by the fragmentation of some of its subunit polypeptides upon morphine or other nucleophilic drugs binding to the active site lysine residue, creating dead-end enzyme-substrate complexes [75]. The active site lysine residue is first activated for nucleophilic attack through Schiff base formation with α-ketoglutarate (α-KG) or glutamate. Nucleophiles with negative reduction potentials induce greater fragmentation of GDH compared to those with positive reduction potentials [76]. Nucleophilic substrates, such as ribonucleoside triphosphates, which possess both binding and polymerization groups, are polymerized into chimerenomic RNA (refer to Appendix 1 for terminologies) [77]. The chimerenomic RNA synthesis activity is dependent on the redox cycle of the hexameric subunit structure of GDH; when the hexamer dissociates in the absence of substrates, the synthetic activity for chimerenomic RNA is lost, although aminating and deaminating activities remain intact.
Thus, this electrochemical system that produces RNAs (chimerenomic RNAs) independent of the genetic code represents a righting (correction) and parallel system that has previously eluded research scientists. This system is highly responsive to environmental changes, capturing every alteration in the electromagnetic and electrochemical signals induced by morphine within the body. In this study, we sequenced the chimerenomic macromolecular RNA enzymes induced by various doses of morphine, paving the way for new therapeutic approaches to treat and potentially reverse morphine and opioid addiction.
4.8 Application in Morphine Astrocyte Study
The investigation into the effects of morphine on human astrocyte cells reveals a comprehensive view of addiction science. We can broadly categorize the interaction of morphine into two primary processes: the binding of morphine to opioid receptors (mu, delta, kappa) and the binding of morphine to glutamate dehydrogenase (GDH) within the cells.
When morphine binds to opioid receptors, it activates a cascade of neurotransmission, intracellular kinase pathways, and drug metabolism processes. These interactions lead to the synthesis of new RNAs and proteins that alter cellular functions. This activation of genetic code-mediated RNA synthesis ultimately results in protein production. It is important to note that RNA synthesis during morphine exposure creates a stressful environment due to the disruption of cellular homeostasis. Consequently, alternative splicing mechanisms generate numerous superfluous RNAs, resulting in the production of abnormal proteins, we referred to as "addiction proteins". These abnormal genetic code-based RNAs and proteins may be specifically related to the stressor, in this case, morphine.
In addition to binding to opioid receptors, morphine also enters astrocytes and binds to GDH. As a potent nucleophile, morphine's primary intracellular target is NADH glutamate dehydrogenase (GDH), where it attaches to the enzyme's active site, forming dead-end morphine-GDH complexes. This binding inhibits the oxidoreductase functions of the subunit polypeptide, prompting cellular proteases to degrade the disabled enzyme molecules. The binding of morphine to NADH-GDH occurs in molar ratios, meaning that the resultant hexameric isoenzyme subunits are proportional to the molar concentration of morphine present. [71].
We developed a 4-dimensional electrochemical system, termed the Chimerenomic Pump, which captures the remaining GDH subunit polypeptides, creates new hexameric complexes, and provides a snapshot of the progression of opioid addiction. Using these newly identified hexameric complexes of NADH-GDH, we synthesized macromolecular RNA molecules that represent all the electrochemical and electromagnetic changes induced by morphine exposure at various concentrations.
From our study three inflection points for opioid addiction have been defined and may have serious implications for clinical applications. The first inflexion point was at the 0.137 mM morphine concentration denoting the morphine threshold of opioid euphoria. The second inflexion point was at 0.27 mM morphine concentration denoting the morphine threshold alarm of opioid intoxication; and the third inflexion point was at 1.1 mM morphine concentration denoting the morphine threshold of full-blown opioid addiction alarm. A threshold is a pre-emptive alert system for an impendent danger. So, molecular chemistry has defined in chimerenomic language as no other science has done here-to-for, the identities of opioid euphoria, opioid intoxication alert; and opioid addiction alarm (see section 3.0).
Therefore, in clinical settings, translating these inflection points, opioid use disorder (OUD) can be classified into 3 distinct clinical conditions here referred to as OUD stage 1, OUD stage 2 and OUD stage 3 each with its own medication remedy as shown in section 3.0 in this paper. These clinical stages are determined by the estimated quantity in molar concentrations that the patient is using or have used in one cycle compressed of 48 hours, akin to the exposure of astrocytes for 48 hours post confluence.
These macromolecular chimerenomic non-genetic code-based RNA enzymes form a parallel mechanism that differs from the processes initiated by morphine binding to opioid receptors on the cell membrane. The macromolecular chimerenomic RNA specific to morphine concentrations will differ from those produced in response to other substances of abuse. These remarkable and unique morphine macromolecular RNA enzymes play a crucial role in reversing many of the cellular and homeostatic dysfunctions associated with addiction by degrading the RNAs responsible for the formation of addiction proteins and facilitating drug metabolism (see sections 3.6.1 and 3.6.2).
4.9.0 Drug Addiction NTinti Macromolecular Treatment Modalities
The landscape of addiction treatment is evolving with the introduction of innovative NTinti macromolecular treatment modalities, particularly in the context of opioid addiction. Our study has revealed that varying concentrations of morphine induce specific electrochemical and electromagnetic changes in astrocytes, leading to the development of concentration-specific Morphine-NTinti RNA enzymes. These enzymes hold the potential to reverse both the somatic and psychological effects associated with specific morphine doses, offering a groundbreaking approach to addiction therapy.
4.9.1 Mechanism of Action: When administered to patients grappling with opioid addiction, Morphine-NTinti RNA enzymes can significantly disrupt the addiction process. They achieve this by degrading homologous mRNAs and other genetic code-based RNAs that play a crucial role in the potentiation of addiction. This targeted degradation not only mitigates the immediate effects of opioid use but also addresses the underlying genetic factors that contribute to addiction. Another mode of action is called the mass action effect and saturation. This is possible because the NTinti RNA macromolecular enzymes is a very large molecule, sometimes containing over 10 billion nucleotide bases ]13], enough to saturate and blunt the neurotransmitters and receptors by electromagnetic repulsion, achieving rapid immediate effects as well.
4.9.2 A Multi-Nodal Strategy: This chimerenomic approach to addiction treatment contrasts sharply with traditional methods that primarily rely on opioid agonist and partial agonist replacement therapies, such as methadone and buprenorphine treatments and the like. While these therapies can alleviate withdrawal symptoms, they often fall short of providing a comprehensive solution. By focusing on a single node—opioid receptors—these treatments can inadvertently create feedback loops that lead to the synthesis of additional addiction-related proteins over time worsening addiction cascade.
In contrast, the multi-nodal effects of opioid-NTinti RNA macromolecules aim to restore homeostasis across various addiction and drug metabolism pathways. This holistic approach effectively disrupts the feedback loops that contribute to tolerance and addiction, offering a more sustainable path to recovery.
4.9.3 Therapeutic Potential: The potential of opioid-NTinti RNA therapy lies in its ability to reverse and prevent the accumulation of “addiction proteins”, which is crucial for achieving lasting recovery from opioid addiction. By addressing the complex interplay of biological factors involved in addiction, this innovative treatment modality offers hope for individuals seeking to break free from the cycle of opioid dependency.
As we continue to explore the frontiers of addiction treatment, the development of opioid-NTinti macromolecular therapies represents a considerable advancement in our understanding and management of opioid addiction. By leveraging the power of chimerenomic sciences, we can pave the way for more effective, multi-faceted treatment strategies that not only alleviate symptoms but also target the root causes of addiction, ultimately fostering a healthier future for those affected by substance use disorders.
4.10 The Next Generation of SUD Treatments: Opioid-NTinti RNA Therapy
The landscape of substance use disorder (SUD) treatments is on the brink of a revolutionary transformation with the advent of Opioid-NTinti RNA therapy, a cutting-edge approach derived from chimerenomic macromolecular RNA technologies. This innovative therapy represents a considerable leap forward in our ability to address the addiction epidemic, offering a multifaceted solution to various forms of substance abuse.
Opioid-NTinti RNA therapy harnesses the power of chimerenomic sciences to create specific RNA molecules designed to target and mitigate the effects of addiction and overdose. By focusing on substances such as fentanyl, hydrocodone, hydromorphone, benzodiazepines, and alcohol, this therapy aims to provide tailored interventions that can effectively disrupt the cycle of addiction.
One of the most compelling aspects of Opioid-NTinti RNA therapy is its potential for precision medicine. Unlike traditional treatments that often take a one-size-fits-all approach, this therapy allows for the customization of treatment plans based on individual needs and the specific substances involved. This targeted approach not only enhances the efficacy of treatment but also minimizes the risk of adverse effects, leading to improved recovery outcomes.
The opioid crisis and the broader addiction epidemic have highlighted the urgent need for innovative solutions. Opioid-NTinti RNA therapy stands out as a promising candidate to fill this gap. By providing a new avenue for intervention, it will empower healthcare providers to tackle addiction more effectively, offering hope to individuals struggling with substance use disorders.
As we look to the future of addiction treatment, Opioid-NTinti RNA therapy represents a beacon of hope. With its potential to revolutionize how we approach substance use disorders, this next-generation treatment could significantly improve the lives of countless individuals and their families.
5.0 Conclusion
A Revolutionary Tool for the Prevention, Treatment, and Cure of Opioid Use Disorders: Chimerenomic Opioid-NTinti Macromolecular RNA Enzymes
In the ongoing battle against substance use disorders (SUD) and addiction, a groundbreaking innovation has emerged: chimerenomic Opioid-NTinti macromolecular RNA enzymes. This advanced therapeutic approach promises to transform the landscape of addiction treatment, offering new avenues for prevention, intervention, and potential cures.
Chimerenomic Opioid-NTinti RNA enzymes are electrochemically constructed molecules designed to target the complex biological mechanisms underlying addiction. By leveraging the principles of chimerenomic science, these enzymes can specifically interact with the genetic and biochemical pathways involved in substance use disorders. The unique structures of redox cycle GDH allow them to produce rapid, non-genetic code-based RNAs that can restore cellular balance and mitigate the effects of addiction.
One of the most promising aspects of chimerenomic Opioid-NTinti RNA enzymes is their potential for addiction prevention. By intervening at the molecular level, these enzymes can help maintain homeostasis within the brain and body, reducing the likelihood of developing addiction in at-risk individuals. This proactive approach could significantly decrease the incidence of substance use disorders, ultimately leading to healthier communities.
For those already struggling with addiction, chimerenomic Opioid-NTinti RNA enzymes offer a targeted treatment option. Unlike traditional therapies that often focus solely on alleviating withdrawal symptoms, these enzymes work to disrupt the underlying biological processes that perpetuate addiction. By degrading specific mRNAs and other genetic materials that contribute to the addiction cycle, they can effectively reduce cravings and withdrawal symptoms, facilitating a smoother path to recovery.
The potential for chimerenomic Opioid-NTinti RNA enzymes to serve as a cure for addiction is particularly exciting. By addressing the root causes of substance use disorders and reversing the biological changes associated with addiction, these enzymes may provide a long-term solution for individuals seeking to reclaim their lives. This revolutionary approach could redefine our understanding of addiction and recovery, moving us closer to a future where addiction is not just managed but cured.
Chimerenomic Opioid-NTinti macromolecular RNA enzymes represent a significant advancement in the fight against substance use disorders and addiction. With their potential for prevention, targeted treatment, and even cure, these innovative tools could change the way we approach addiction, offering hope to millions affected by this pervasive issue. As research continues to unfold with needed clinical trials for these new medications, the promise of these enzymes may lead to a new era of addiction treatment, ultimately fostering healthier lives and communities.
Appendix 1:
New Terminologies: Chimerenomic glossary for the new terminologies in life sciences.
independent RNA processes that control the survival of cells and organisms other than genes. The building blocks of this life regulatory system are made up of a unique type of RNA that are not coded nor synthesized through the genetic code. These template-independent RNAs are called chimerenomic RNAs.
chimmerization, chimere etc) about chimerenomic RNAs. Chimerenomics confers molecular chemistry pluripotency and totipotency to all cells and tissues. Chimerenomics are the processes by which whole organisms, cells and tissues differentiate, develop and grow by chigramming chimerenomic RNAs that interact with the changing physicochemical internal and external environmental conditions thereby reprogramming and optimizing those metabolic reactions that assure the continued survival of the organism.
mRNA and other genetic code-based RNAs. Chimere is the active segment of NTinti.
glutamate dehydrogenase hexameric redox cycle isoenzymes (GDH) in response to a specific environmental change. NTinti is also synthesized naturally in vivo during normal tissue differentiation, growth and development. Therefore, NTinti can be cell or tissue specific. One NTinti has more than one chimere.
spontaneous process. It is the conversion of the electromagnetic changes in the environmental conditions of cells, tissues, whole organisms to the nucleotide sequences of chimerenomic RNAs.
in response to a new environment leading to new hexameric isoenzyme complexes. This is the initiation process for chigramming.
NTinti.
from same or different tissues under various environmental conditions.
a). Clinical Chimerenomics: The application of chimerenomics to clinical studies.
b). Chimerenomic Medicine: This is the application of chimerenomics to primary care in the prevention and treatment of human disorders, diseases and wellness conditions in humans.
c). Chimerenomic Chemistry
d). Chimerenomic Physiology
e). Molecular Chimerenomics
f). Chimerenomic Biology
g). Chimerenomic Pharmacology etc.
[1]. Fowler JS, Volkow ND, Kassed CA, Chang L (2007). Imaging the addicted human brain. Sci Pract Perspect 3: 4-16.
[2]. Lander L, Howsare J, Byrne M (2013). The impact of substance use disorders on families and children: from theory to practice. Soc Work Public Health. 28: 194-205.
[3]. Goldberg DS, McGee SJ (2011). Pain as a global public health priority. BMC Public Health. 2011 Oct 6; 11:770. doi: 10.1186/1471-2458-11-770. PMID: 21978149; PMCID: PMC3201926.
[4]. NIDA (2020). https://www.nih.gov/opioid-crisis. Accessed Sept. 2020.
[5]. Smith HS (2009). Opioid metabolism. Mayo Clinic Proceedings. 84: 613-624.
[6]. Armstrong SC, Cozza KL (2003). Pharmacokinetic drug interactions of morphine, codeine, and their derivatives: Theory and clinical reality, part ii. Psychosomatics 44: 515-520.
[7]. Cox JJ, Reimann F, Nicholas AK, Thornton G, Roberts E, Springell K, Karbani G, Jefri H et al. (2006). An SCN9A channelopathy causes congenital inability to experience pain. Nature 14: 444(7121): 894-898. doi.1038/nature05413.
[8]. Costandi M (2021). The future of chronic pain. https://neo.life/2021/05/the-future-of-chronic-pain/. Accessed May 1, 2021.
[9]. Howell LL, Murnane KS (2008). Nonhuman primate neuroimaging and the neurobiology of psychostimulant addiction. Annals of the New York Academy of Sciences. 1141: 176-194.
[10]. Osuji GO, Okea RN (2024). Environment-wide reprogramming of the total RNA abundance and metabolic processes by glutamate dehydrogenase-synthesized RNA enzyme: Terminologies for the new RNAs. JAAPCR vol. 1: Issue 2.
[11]. Allen RS, Miller JAC, Chitty JA, Fist A, Gerlach WL, Larkin PJ (2008). Metabolic engineering of morphinan alkaloids by over-expression and RNAi suppression of salutaridinol 7-O-acetyltransferase in opium poppy. Plant Biotechnology Journal 6: 22-30.
[12]. Boettcher C, Fellermeier M, Boettcher C, Drager B, Zenk MH (2005). How human neuroblastoma cells make morphine. PNAS 102(24): 8495-8500.
[13]. Okea RN, Osuji GO (2025). New treatment for Alzheimer’s dementia and Parkinson’s disease ready for clinical trial: The chimerenomic RNA enzyme. JAAPCR vol. 2: issue 3.
[14]. Osuji GO, Madu WC, Johnson PM (2019). Total RNA degradation in vitro and in vivo by glutamate dehydrogenase-synthesized RNA enzyme: Biotechnological applications. Advances Bioscience. Biotechnol. 10: 59-85.
[15]. Osuji GO, Johnson PM, Madu WC (2021a). Electrophoretic purification and characterization of human NADH-glutamate dehydrogenase redox cycle isoenzymes synthesizing nongenetic code-based RNA enzyme. Advances in Enzyme Research 9: 19-35.
[16]. Okea RN, Osuji GO (2024). Transformation from growth to aging in human astrocytes cell culture: The role of NADH-glutamate dehydrogenase isoenzymes. JAAPCR vol. 1: Issue 2.
[17]. Pan YX, Xu J, Mahurter L, Xu M, Gilbert AK, Pasternak GW (2003). Identification and characterization of two new human mu opioid receptor splice variants, hMOR-1O and hMOR-1X. Biochem. Biophys. Res. Commun. 301 (4), 1057-1061.
[18]. Mansson E, Bare L, Yang D (1994). Isolation of a human kappa opioid receptor cDNA from placenta. Biochem. Biophys. Res. Commun. 202 (3), 1431-1437.
[19]. Simonin F, Gavériaux-Ruff C, Befort K, Matthes H, Lannes B, Micheletti G, Mattéi MG, Charron G, Bloch B, Kieffer B {1995). kappa-Opioid receptor in humans: cDNA and genomic cloning, chromosomal assignment, functional expression, pharmacology, and expression pattern in the central nervous system. Proc Natl Acad Sci U S A. 1995 Jul 18;92(15):7006-10. doi: 10.1073/pnas.92.15.7006..
[20]. Andersen S, Baar C, Fladvad T, Laugsand EA, Skorpen F (2013). The N-terminally truncated µ3 and µ3-like opioid receptors are transcribed from a novel promoter upstream of exon 2 in the human OPRM1 gene. PLoS One. 2013 Aug 12;8(8):e71024. doi: 10.1371/journal.pone.0071024.
[21]. Potier MC, Spillantini MG, Carter NP (1992). The human glutamate receptor cDNA GluR1: cloning, sequencing, expression and localization to chromosome 5. DNA Seq. 2 (4), 211-218.
[22]. Strausberg R, Feingold EA, Grouse LH, Derge JG, Klausner RD, Collins FS, Wagner L, Shenmen CM et al., (2002). Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903
[23]. Bruss M, Eucker T, Gother M, Bonisch H (2000). Exon-intron organization of the human 5-HT3A receptor gene. Neuropharmacology 39 (2), 308-315.
[24]. García-Pardo MP, Roger-Sanchez CR, Rodríguez-Arias M, Miñarro J, Aguilar MA (2016). Pharmacological modulation of protein kinases as a new approach to treat addiction to cocaine and opiates. Eur. J. Pharmacol. 2016 Jun 15:781:10-24.
doi: 10.1016/j.ejphar.2016.03.065.
[25]. Gallo KA, Mark MR, Scadden DT, Wang Z, Gu Q, Godowski PJ (1994). Identification and characterization of SPRK, a novel src-homology 3 domain-containing proline-rich kinase with serine/threonine kinase activity. J. Biol. Chem. 269 (21), 15092-15100.
[26]. Osuji GO, Brown TK, South SM (2008). Discovery of the RNA synthetic activity of glutamate dehydrogenase and its application in drug metabolism research. The Open Drug Metabolism Journal 2: 1-13.
[27]. Sonoda H, Aoki J, Hiramatsu T, Ishida M, Bandoh K, Nagai Y, Taguchi R, Inoue K. Arai H (2002. A novel phosphatidic acid-selective phospholipase A1 that produce lysophosphatidic acid. J. Biol. Chem. 277 (37), 34254-34263.
[28]. Sherman L, Dafni N, Lieman-Hurwitz J, Groner Y (1983). Nucleotide sequence and expression of human chromosome 21-encoded superoxide dismutase mRNA. Proc. Natl. Acad. Sci. U.S.A. 80 (18), 5465-5469.
[29]. Sakajo S, Minagawa N, Komiyama T, Yoshimoto A (1991). Molecular cloning of cDNA for antimycin A-inducible mRNA and its role in cyanide-resistant respiration in Hansenula anomala. Biochim. Biophys. Acta 1090 (1), 102-108.
[30]. Hubatsch I, Ridderstrom M, Mannervik B (1998). Human glutathione transferase A4-4: an alpha class enzyme with high catalytic efficiency in the conjugation of 4-hydroxynonenal and other genotoxic products of lipid peroxidation. Biochem. J. 330 (PT 1), 175-179.
[31]. Allikmets R, Gerrard B, Hutchinson A, Dean M (1996). Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database. Hum. Mol. Genet. 5 (10), 1649-1655.
[32]. Mayo Clinic (2024). How opioid use disorder occurs. Original article: https://www.mayoclinic.org/diseases-conditions/prescription-drug-abuse/in-depth/how-opioid-addiction-occurs/art-20360372. Accessed May 20, 20 2025.
[33]. Golovin S, Karginov VA, Bondar' AA, Beklemishev AB, Chekhranova MK(1987). Synthesis, cloning and primary structure of DNA complementary to mRNA for human pituitary pro-opiomelanocortin. Bioorg Khim. 1987 Apr;13(4):562-4.
[34]. Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD, Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF, Zeeberg B, Buetow KH, Schaefer CF, Bhat NK et al. Mammalian Gene Collection Program Team. (2002). Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad. Sci U S A. 2002 Dec 24; 99(26):16899-903. doi: 10.1073/pnas.242603899.
[35]. Osuji GO, Braithwaite C, Pointer R, Reyes J (1999). Pesticide inactivation of peanut glutamate dehydrogenase: Biochemical basis of the enzyme's isomerization. J. Agricultural and Food Chemistry 47: 3345-3351.
[36]. Osuji GO, Madu WC, Johnson PM (2019). Total RNA Degradation in Vitro and in Vivo by Glutamate Dehydrogenase-Synthesized RNA Enzyme: Biotechnological Applications. Advances in Bioscience and Biotechnology. Vol.10 No.4.
[37]. Osuji GO, Brown TK, South SM, Johnson D, Hyllam S (2012). Molecular modeling of metabolism for allergen-free low linoleic acid peanuts. Applied Biochemistry and Biotechnology. 168: 805-823. DOI 10.1007/s12010-012-9821-6.
[38]. Osuji GO, Brown TK, South SM, Duncan JC, Johnson D (2011). Doubling of crop yield through permutation of metabolic pathways. Advances Bioscience and Biotechnology 2: 364-379.
[39]. Osuji GO, Johnson PM, Madu WC (2021b). Optimization of cowpea dry grain yield through the stimulation of the RNA synthetic activity of NADH-glutamate dehydrogenase. American J. Plant Sciences 12: 71-103.
[40]. Pathan H, Williams J (2012). Basic opioid pharmacology: an update. British J. Pain 6: 11-16.
[41]. Serohijos AWR, Yin S, Ding F, Gauthier J, Gibson DG, Maixner W et al. (2011). Structural basis for mu-opioid receptor binding and activation. Structure 19: 1683-1690.
[42]. Park TIH, Smyth LCD, Aalderink M et. al. (2022). Routine culture and study of adult human brain cells from neurosurgical specimens. Nat. Protoc. 17: 190–221. https://doi.org/10.1038/s41596-021-00637-8.
[43]. Ng KW, Jan-Thorsten Schant A (2010). Manual for Primary Human Cell Culture. https://doi.org/10.1142/5501World Scientific, 2010.
[44]. Ungerleider K, Beck J, Lissa D, Turnquist C, Horikawa I, Harris BT, Harris CC. Astrocyte senescence and SASP in neurodegeneration: tau joins the loop. Cell Cycle. 2021 Apr;20(8):752-764. doi: 10.1080/15384101.2021.1909260. Epub 2021 Apr 5. PMID: 33818291; PMCID: PMC8098067.
[45]. Singer JM, Pedroso-de-Lima AC, Tanaka NI, González-López VA.To triplicate or not to triplicate? Chemometrics and Intelligent Laboratory Systems. Volume 86, Issue 1, 15 March 2007, Pages 82-85
[46]. Niepel M, Marc Hafner M, Mills CE, Subramanian K, Williams EH, Mirra Chung M, Gaudio B, Barrette AM, Stern AD, Bin Hu B, Korkola JE, LINCS Consortium, Gray JW, Marc R. Birtwistle MR, Heiser LM, Peter K. Sorger PK (2019). A Multi-center Study on the Reproducibility of Drug-Response Assays in Mammalian Cell Lines. Cell Syst. 2019 Jul 24; 9(1): 35–48.e5 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6700527/
[47]. Cordula HC, Schilknecht S (2019). In Vitro Research Reproducibility Keeping Up High Standard. Front Pharmacol. 10: 1484.
[48]. Lowry OH, Rosenbrough NJ, Farr A, Randall RJ (1951) Protein Measurement with the Folin-Phenol Reagent. Journal of Biological Chemistry, 193: 265-275.
[49]. Schaefer CP, Tome ME, Davis TP (2017). The opioid epidemic: a central role for the blood brain barrier in opioid analgesia and abuse. Fluids and Barriers of the CNS. 14, Article number 32.
[50]. Leskelä TT, Markkanen PM, Pietilä EM, Tuusa JT, Petäjä-Repo UE (2007). Opioid receptor pharmacological chaperones act by binding and stabilizing newly synthesized receptors in the endoplasmic reticulum. J Biol Chem. 2007 Aug 10;282(32):23171-83. doi: 10.1074/jbc.M610896200.
[51]. Gelernter J, Kranzler HR. (2000). Variant detection at the delta opioid receptor (OPRD1) locus and population genetics of a novel variant affecting protein sequence. Hum Genet. 2000 Jul;107(1):86-8. doi: 10.1007/s004390000340.
[52]. Lee AM, Messing RO (2008). Protein Kinases and Addiction. Annals N Y Acad. Sci. 2008 Oct; 1141:22–57. doi: 10.1196/annals.1441.022.
[53]. Gaertner TR, Kolodziej SJ, Wang D, Kobayashi R, Koomen JM, Stoops JK, Waxham MN (2004). Comparative analyses of the three-dimensional structures and enzymatic properties of alpha, beta, gamma and delta isoforms of Ca2+-calmodulin-dependent protein kinase II. J Biol Chem. Mar 26;279(13):12484-94. doi: 10.1074/jbc.M313597200. Epub 2004 Jan 12. PMID: 14722083.
[54]. Oyen O, Myklebust F, Scott JD, Hansson V, Jahnsen T (1989). Human testis cDNA for the regulatory subunit RII alpha of cAMP-dependent protein kinase encodes an alternate amino-terminal region. FEBS Lett 246(1-2):57-64. doi: 10.1016/0014-5793(89)80253-4.
[55]. Herbrechter R, Hube N, Buchholz R, Reiner A. (2021). Splicing and editing of ionotropic glutamate receptors: a comprehensive analysis based on human RNA-Seq data. Cell Mol Life Sci. 2021 Jul;78(14):5605-5630. doi: 10.1007/s00018-021-03865-z.
[56]. Wu S, Wright RA, Rockey PK, Burgett SG, Arnold JS, Rosteck PR Jr, Johnson BG, Schoepp DD, Belagaje RM (1998). Group III human metabotropic glutamate receptors 4, 7 and 8: molecular cloning, functional expression, and comparison of pharmacological properties in RGT cells. Brain Res Mol Brain Res. 1998 Jan;53(1-2):88-97. doi: 10.1016/s0169-328x(97)00277-5.
[57]. Malherbe P, Kratzeisen C, Lundstrom K, Richards JG, Faull R, Mutel V (1999).
Cloning and functional expression of alternative spliced variants of the human metabotropic glutamate receptor 8. Brain Res. Mol. Brain Res. 67 (2), 201-210.
[58]. Fuchs C, Abitbol K, Burden JJ, Mercer A, Brown L, Iball J, Anne Stephenson F, Thomson AM, Jovanovic JN (2013). GABA(A) receptors can initiate the formation of functional inhibitory GABAergic synapses. Eur. J. Neurosci. 38:3146-3158.
[59]. Adas F, Salaün JP, Berthou F, Picart D, Simon B, Amet Y. (1999). Requirement for omega and (omega;-1)-hydroxylations of fatty acids by human cytochromes P450 2E1 and 4A11. J. Lipid Res. 1999 Nov;40(11):1990-7.
[60]. Hallewell RA, Masiarz FR, Najarian RC, Puma JP, Quiroga MR, Randolph A, Sanchez-Pescador R, Scandella CJ, Smith B, Steimer KS, et al. (1985). Human Cu/Zn superoxide dismutase cDNA: isolation of clones synthesizing high levels of active or inactive enzyme from an expression library. Nucleic Acids Res. 1985 Mar 25;13(6):2017-34. doi: 10.1093/nar/13.6.2017.
[61]. Giordano L, Aneja MK, Sommer N, et al. (2022). Alternative oxidase encoded by sequence-optimized and chemically-modified RNA transfected into mammalian cells is catalytically active. Gene Ther. 29, 655–664. https://doi.org/10.1038/s41434-021-00235-z
[62]. Hubatsch I, Ridderström M, Mannervik B (1998). Human glutathione transferase A4-4: an alpha class enzyme with high catalytic efficiency in the conjugation of 4-hydroxynonenal and other genotoxic products of lipid peroxidation. Biochem J. 1998 Feb 15;330 (Pt 1)(Pt 1):175-9. doi: 10.1042/bj3300175.
[63]. Pilozzi A, Carro C, Huang X (2021). Roles of Endorphin in Stress, Behavior, Neuroinflammation, and Brain Energy Metabolism. Int. J. Mol. Sci. 2021, 22, 338. https://doi.org/10.3390/ijms22010338.
[64]. Lerner T.N. et al. (2015). Intact-Brain Analyses Reveal Distinct Information Carried by SNc Dopamine Subcircuits. Cell, Vol. 162, Issue 3, 635 – 647.
[65]. Huang S, Borgland SL, Zamponi GW (2019). Peripheral nerve injury-induced alterations in VTA neuron firing properties. Mol Brain 12, 89.
[66]. Cai J, Tong Q (2022). Anatomy and Function of Ventral Tegmental Area Glutamate Neurons. Front Neural Circuits. 2022 May 20;16: 867053. doi: 10.3389/fncir.2022.867053. PMID: 35669454; PMCID: PMC9164627.
[67]. Holly EN, Miczek KA (2016). Ventral tegmental area dopamine revisited: effects of acute and repeated stress. Psychopharmacology (Berl). 2016 Jan;233(2):163-86. doi: 10.1007/s00213-015-4151-3. Epub 2015 Dec 17. PMID: 26676983; PMCID: PMC4703498.
[68]. Beier KT et al. (2015). Circuit Architecture of VTA Dopamine Neurons Revealed by Systematic Input-Output Mapping. 2015 Cell, Volume 162, Issue 3, 622 – 634.
[69]. Al-Chalabi M, Reddy V, Gupta S (2025). Neuroanatomy, Spinothalamic Tract. [Updated 2023 Aug 14]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2025 Jan-. Available from: https://www.ncbi.nlm.nih.gov/books/NBK507824/
[70]. Yam MF, Loh YC, Tan CS, Khadijah Adam S, Abdul Manan N, Basir R (2018). General Pathways of Pain Sensation and the Major Neurotransmitters Involved in Pain Regulation. Int J Mol Sci. 2018 Jul 24;19(8):2164. doi: 10.3390/ijms19082164. PMID: 30042373; PMCID: PMC6121522.
[71]. Kruyer A, Scofield MD (2021). Astrocytes in Addictive Disorders. Adv Neurobiol. 2021;26:231-254. doi: 10.1007/978-3-030-77375-5_10. PMID: 34888837; PMCID: PMC9060395].
[72]. Chaudhry SR, Gossman W (2023). Biochemistry, Endorphin. [Updated 2023 Apr 3]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2025 Jan-. Available from: https://www.ncbi.nlm.nih.gov/books/NBK470306/
[73]. Sprouse-Blum AS, Smith G, Sugai D, Parsa FD (2010). Understanding endorphins and their importance in pain management. Hawaii Med J. 2010 Mar; 69(3):70-1. PMID: 20397507; PMCID: PMC3104618.
[74]. Gibula-Tarlowska E, Kotlinska JH (2020). Crosstalk between Opioid and Anti-Opioid Systems: An Overview and Its Possible Therapeutic Significance. Biomolecules. 2020 Sep 28;10(10):1376. doi: 10.3390/biom10101376. PMID: 32998249; PMCID: PMC7599993.
[75]. Brown A, Culver JM, Fisher HF (1973). Mechanism of inactivation of L-glutamate dehydrogenase by pyridoxal and pyridoxal phosphate. Biochemistry, 12, 4367-4374.
[76]. Osuji GO, Braithwaite C (1999). Signaling by glutamate dehydrogenase in response to pesticide treatment and nitrogen fertilization of peanut. J. Agric. Food Chem. 47, 3332-3344.
[77]. Osuji, G.O.; Braithwaite, C.; Fordjour, K.; Madu, W.C.; Beyene, A.; Roberts, P.S.; Wright, V. (2003). Purification of glutamate dehydrogenase isoenzymes and characterization of their substrate specificities. Prep. Biochem. Biotechnol. 33, 13-28.
Table 1: GenBank accession numbers of mRNAs that are homologous to chimerenomic macromolecular NTinti RNA enzymes of Astrocyte cells treated with Morphine concentrations.
|
Serial Nos |
GenBank Accession Nos |
Encoding human mRNA |
|
|
Table 2: Showing the first lines of Synthesized Chimerenomic Non Genetic Code-base RNA Sequences for Control and Morphine Concentration, at Pre and Post Confluence Experimental Stages
|
Concentrations |
Data Set |
First line of sequence out of the total millions of lines of sequences as shown
|
|
Control A |
CHC001 |
CNCCAGGCGGTCAACTTAATGCGTTAGCTGCGCCACTAAAAGCTCAAGGCTTCCAACGGCTAGTTGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTCAGTGTCAGTATTAGTCCAG. 1 of 31,670,251 unique lines of sequences
|
|
|
CHC002 |
GAAGGCGACCACCTGGACTAATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCAACTAGCCGTTGGAAGCCTTGAGCTTTTAGTGGCGCAGCTAACGCATTAAGTT. 1 of 31,670,251 unique lines of sequences
|
|
Control B |
CHC003 |
NTTCCCTTTTCACGACGGACGTTAGCACCCGCCGTGTGTCTCCCAGGCTCGGCACTTGTCGGTATTAGGAGTTTGCATCGGTTTGGTAAGTCGGGCTGACCCCCTAGCCGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGCT. 1 of 35,534,202 unique lines of sequences
|
|
|
CHC004 |
CGGCTAGGGGGTCATCCCGACTTACCAAACCGATGCAAACTCCGAATACCTACAAGTGCCGAGCATGGGAGACACACGGCGGGTGCTAACGTCCGTCGTGAAAAGGGAAAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTA. 1 of 35,534,202 unique lines of sequences
|
|
Morphine 1.1 mM gpA |
CHC009 |
CCCGTTACATCTTCCGCGCAGGCCGACTCGACTAGTGAGCTATTACGCTTTCTTTAAAGGGTGGCTGCTTCTAAGCCAACCTCCTAGCTGTCTAAGCCTTCCCACATCGTTTCCCACTTAACCATAACTTTGGGACCTTAGCTGACGGTC. 1 of 32,121,517 unique lines of sequences
|
|
|
CHC010 |
CCCGACTTACCAAACCGATGCAAACTCCGAATACCTACAAGTGCCGAGCATGGGAGACACACGGCGGGTGCTAACGTCCGTCGTGAAAAGGGAAACAACCCAGACCGTCAGCTAAGGTCCCAAAGTTATGGTTAAGTGGGAAACGATGTG. 1 of 32,121,517 unique lines of sequences
|
|
Morphine 1.1 mM gpB |
CHC011 |
GTTCAGGCGGCCCAGGTCCAGCGGCGCAAACGTGCCGTCAGCCAGGGTGATACGGATCGAGGGGTGAGCTTGCACGGCCGCTTCTTCAGCCGGGGTGCGTACGGCGCGTTACTTGGAACGGGCGTCACGGTAGATCACGTAGTCGCGCGC. 1 of 24,000,387 unique lines of sequences
|
|
|
CHC012 |
CACCTGGCCAATTGCGCGTGATCAAGCGTAACGGCACTGTCGTTCCTTACACCGATGACAAAATCACCGTCGCCATCACCAAAGCGTTTCTTGCAGTTGAAGGCGGCACCGCTGCTGCCTCGTCGCGCATCCACGACACCGTTGCCCGCC. 1 of 24,000,387 unique lines of sequences
|
|
Morphine 0.27 mM gpA |
CHC013 |
NCCCAGGCGGTCAACTTAATGCGTTAGCTGCGCCACTAAAAGCTCAAGGCTTCCAACGGCTAGTTGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTCAGTGTCAGTATTAGTCCAG. 1 of 38,555,342 unique lines of sequences
|
|
|
CHC014 |
AAGGCGACCACCTGGACTAATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCAACTAGCCGTTGGAAGCCTTGAGCTTTTAGTGGCGCAGCTAACGCATTAAGTTG. 1 of 38,555,342 unique lines of sequences
|
|
Morphine 0.27 mM gpB |
CHC015 |
CNTGGTATTCTCTACCCAACCACCTGTGTCGGTTTGGGGTACGGTTCCTGGTTACCTGAAGCTTAGAAGCTTTTCTTGGAAGCATGGCATCAACCACTTCGTTAACTAAAAGTTAACTCGTCATCAGCTCTCGGCCTTGAAATCCCGGAT. 1 of 31,365,304 unique lines of sequences
|
|
|
CHC016 |
TGGTTGTCCAAGTTTAAGGTGGTAGGCTGAAATCTTAGGTAAATCCGGGATTTCAAGGCCGAGAGCTGATGACGAGTTAACTTTTAGTTAACGAAGTGGTTGATGCCATGCTTCCAAGAAAAGCTTCTAAGCTTCAGGTAACCAGGAACC. 1 of 31,365,304 unique lines of sequences
|
|
Morphine 0.137 mM gpA |
CHC017 |
NCTCCCCACGCTTTCGCACCTCAGTGTCAGTATTAGTCCAGGTGGTCGCCTTCGCCACTGGTGTTCCTTCCTATATCTACGCATTTCACCGCTACACAGGAAATTCCACCACCCTCTACCATACTCTAGTCAGTCAGATTTGAATGCAGT. 1 of 37,522,825 unique lines of sequences
|
|
|
CHC018 |
GTGGTTTGTTAACTTGGATGTGAAATCCCCGGGCTCAACATGGGAACTGCATTCAAAACTGACTGACTAGAGGATGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGCAAGGAACACCAGTGGCGAAGGCGA. 1 of 37,522,825 unique lines of sequences
|
|
Morphine 0.137 mM gpB |
CHC019 |
GNCCCTTCAGGGAACTCAAGGTTCCAGTGAGATCTCATCTTGAGGCTAGTTTCCCGCTTAGATGCTTTCAGCGGTTATCTATTCCGAACATAGCTACCCGGCAATGCCACTGGCGTGACAACCGGAACACCAGAGGTTCGTCCACTCCGG. 1 of 31,702,353 unique lines of sequences
|
|
|
CHC020 |
GGCTGCTCCTAGTACGAGAGGACCGGAGTGGACGAACCTCTGGTGTTCCGGTTGTCACGCCAGTGGCATTGCCGGGTAGCTATGTTCGGAATAGATAACCGCTGAAAGCATCTAAGCGGGACACTAGCCTCAAGATGAGATCTCACTGGA. 1 of 31,702,353 unique lines of sequences |
Group A represent Pre-confluence
group B represent Post-confluence
Full data is available at www.chimerenomics.com
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle