Description

Table 1: Chimerenomic Terminologies: glossary for the new life sciences.

1.These new terminology in life sciences describe the discovery of template-independent RNA processes that control the survival of cells and organisms other than genes. The building blocks of this life regulatory system are made up of a unique type of RNA that are not coded nor synthesized through the genetic code. These template-independent RNAs are called chimerenomic RNAs.

2.Chimerenomics: Is the study of everything (NTintis, chigramming, GDH-

chimmerization, chimere etc) about chimerenomic RNAs. Chimerenomics confers molecular chemistry pluripotency and totipotency on all cells and tissues. Chimerenomics are the processes by which whole organisms, cells and tissues differentiate, develop and grow by chigramming chimerenomic RNAs that interact with the changing physicochemical internal and external environmental conditions thereby reprogramming and optimizing those metabolic reactions that assure the continued survival of the organism.

3.Chimere: Is the minimum length of nucleotide sequence that can degrade homologous mRNA and other genetic code-based RNAs. Chimere is the active segment of NTinti.

4.NTinti: This is the chimerenomic RNA molecule chigrammed (synthesized) by NADH-

glutamate dehydrogenase hexameric redox cycle isoenzymes (GDH) in response to a specific environmental change. NTinti is also synthesized naturally in vivo during normal tissue differentiation, growth and development. Therefore, NTinti can be cell or tissue specific. One NTinti has more than one chimere.

5.Chigramming: This is the process of synthesis/construction/configuring of chimeres and NTintis by GDH. They are spontaneous processes. It is the conversion of the magnetoelectric changes in the environmental conditions of cells, tissues, whole organisms to the nucleotide sequences of chimerenomic RNAs.

6.GDH-Chimmerization: is the formation of chemical Schiff base of GDH isoenzymes

in response to a new environment leading to new hexameric isoenzyme complexes. This is the initiation process for chigramming.

7.Functional chimerenomics: is the study of the biological functions of chimere and NTinti.

8.Differential chimerenomics: is the comparison study of the chimeres and NTintis

from same or different tissues under various environmental conditions.

9. ATinti RNA: These are large chimerenomic RNAs chigrammed from one single lane of GDH charged isomer, they are smaller than NTinti that are produced from multiple lanes of GDH charged isomers.

10. Non-chimerenomic RNAs: This refers to other RNAs from genetic code-based RNAs such as mRNA, tRNA, rRNA, siRNA, miRNA, lncRNA, shRNA, etc.

11. Other life science terminologies

a). Clinical Chimerenomics: The application of chimerenomics to clinical studies.

b). Chimerenomic Medicine: The application of chimerenomics to primary care in the prevention and treatment of human disorders, diseases and wellness conditions.

c). Chimerenomic Chemistry

d). Chimerenomic Physiology

e). Molecular Chimerenomics

f). Chimerenomic Biology

g). Chimerenomic Pharmacology

h). Biomedical Engineering Chimerenomics

 i) Chimerenomic Hematology etc.

1.0    Introduction

When the magnetoelectric environmental conditions of an organism have changed, the conformation of hexameric NADH-glutamate dehydrogenase changes (GDH), and it produces template independent NTinti (nongenetic code-based chimerenomic) RNA enzyme that degrades abnormal genetic code-based RNAs [1, 2]. Many research programs have been undertaken successfully to harness the properties of the nongenetic code-based NTinti RNA enzyme towards the understanding of human disease prognosis and therapy [2, 3]. There are many differences between chimerenomic nongenetic code-based RNA and genetic code-based RNA. Chimerenomic RNA is a liquid and has flexible structure, chigrammed by GDH, induced by environmental exposure, more thermally stable, is RNA enzyme, degrades genetic code-based RNA in vitro and in vivo, not translatable, clinical use does not cause abnormal protein production, has high potential energy [3]. Conversely, genetic code-based RNA is a solid, has steric hindrance, transcribed from DNA, is driven by genetics, thermally unstable, has no enzyme activity, is translatable, easily cleaved, clinical use causes abnormal protein production, has low potential energy, does not degrade total RNA in vitro. By targeting the aberrant genetic code-based RNA sequences, NTinti RNAs enhance the precision of therapeutic interventions, making them available in modern medicine [2,3]. Hereunder we present research evidence that shows how chimerenomic RNA enzyme degrades superfluous and abnormal genetic code-based RNA but not normal genetic code-based RNA. 

2.0    Materials and Methods

2.1 Plant Material: Treatment of Peanuts with Mineral Salt Solutions.Peanut (Arachis hypogaea L. Cv. Virginia) seeds were planted in boxes 242 × 244 × 31 cm (width × length × depth) [4], each filled with Metro-Mix 700 peat moss. About 100 - 110 seeds were planted per box. The applied mineral salt compositions targeted the binomial subunit polypeptide compositions of the GDH isoenzymes [5]. The first box was left as the untreated control; the second box (N) was treated with 1 L of NH₄Cl solution (25 mM), the third box (Pi) was treated with 1 L of Na₂HPO₄ solution (20 mM); the fourth box (S) was treated with 1 L of Na₂SO₄ solution (50 mM); the fifth box (N + P + K + S) was treated with 1 L of combined NH₄Cl (25 mM), Na₂HPO₄ (20 mM), Na₂SO₄ (50 mM), and KCl (4 mM) solution; the sixth  box (P + K) was treated with 1 L of combined Na₂HPO₄ (20 mM) and KCl (4 mM) solution; the seventh box (N + S) was treated with 1L of combined NH₄Cl (25 mM) and Na₂SO₄ (50 mM) solution; the eighth box (P + N) was treated with 1 L of combined Na₂HPO₄ (20 mM) and NH₄Cl (25 mM) solution; the nineth box (P + S) was treated with 1 L of combined Na₂HPO₄ (20 mM) and Na₂SO₄ (50 mM) solution as described before [4]. The boxes were watered every other day. Mineral salt solutions were applied sequentially, first at pre-flowering stage (2 weeks after seed germination), second at flowering, and thirdly at post-flowering. When the leaves turned yellow (peanut maturity), seeds were harvested, allowed to dry on the greenhouse floor for about 2 weeks, and weighed; and stored at –30˚C.

2.2 Production  of GDH Hexameric Isoenzymes: GDH was extracted from the peanut seeds (30 g) by homogenization at 4 ⁰C with 100 mL of buffer [4, 5, 6, 7] containing 5 units per mL of each of RNase A and DNase 1, and subjected to fractional (NH₄)₂SO₄ precipitation, preparative-scale isoelectric focusing (IEF; Rotofor, Bio-Rad, Hercules, USA) followed by dialysis of the fractions as described before [8]. Rotofor fractions (0.2 mL) were purified by native 7.5 % polyacrylamide gel electrophoresis (PAGE) (100 V, 20 h, 4 ⁰C) to remove other proteins, and nucleic acid contaminations. Bio-Rad protean II cell was used for duplicate gel electrophoresis. After the electrophoresis, one gel was stained with phenazine methosulphate/tetrazolium blue reagent to reveal the GDH hexameric isoenzyme distribution pattern [6, 7, 8]; the result was photo-documented. GDH isoenzymes were eluted (30 min, 100 V) from the second electrophoresed gel with 0.05 M solution of Tris base at subzero temperature using whole gel eluter (Bio-Rad) as described before [6, 7, 8]. The whole gel fractions were not combined but each fraction was applied to chigram chimerenomic (nongenetic code-based) RNA.

2.3 Chimerenomic RNA Production: RNAs were chigrammed with the whole-gel fractions of GDH charge isomers purified from the control or mineral salt-treated peanut seeds. RNA chigramming was conducted in the combined amination and deamination substrate solutions containing 0.87 mM NH₄Cl, 3.5 mM CaCl₂,10.0 mM α-ketoglutarate (α-KG), 0.23 mM NADH, 0.6 mM each riboNTP, 0.37mM NAD⁺, 3.23 mM L-glutamate, 5 Units of RNase inhibitor, 5 Units of DNase 1, and 5.0µg actinomycin D. Chigramming was with 0.2 mL of GDH charge isomers containing about 4 µg protein per mL as described before [6]. The final volume of the reaction was brought to 0.4 mL and pH 8 with Tris-HCl solution. Reactions were incubated at 16 ⁰C overnight and stopped by phenol-chloroform (pH 4.5) extraction of the enzyme. The RNA was precipitated with ethanol; then electrophoresed through 2% agarose gel, the results were photo-documented. RNA chigramming with GDH charge isomers per harvested treated peanut seeds were repeated several times, and after glyoxal-agarose gel electrophoresis, the RNA fractionation patterns were trans-blotted to nylon membrane ready for Northern hybridization screenings.

2.4 Restriction Fragment Differential Display PCR: In order to prepare the probes for analyzing the degradation of genetic code-based RNA by the nongenetic code-based RNA enzyme chigrammed by GDH, cDNAs of the nongenetic code-based RNAs were synthesized with 2µg of each product RNA chigrammed by the GDH charge isomers using random hexamer primer, and the restriction fragment differential display (RF-DD) PCR was conducted according to the methods of Display Systems Biotech, Vista, CA, USA. Selected cDNA fragments were subcloned into pCR4-TOPO vector and transformed into TOP10 One Shot Chemically Competent Escherichia coli (Invitrogen, Carlsbad, CA), followed by overnight growth on selective plates. Up to ten positive transformant colonies were picked per plate and cultured overnight in LB medium containing 50 µg/mL of ampicillin. Plasmid DNA was purified with a plasmid kit (Novagen, Madison, WI), and the insert cDNA fragment was sequenced with T3 and T7 primers by Genemed Synthesis, Inc (South San Francisco, CA, USA).

2.5 Functional and Structural Characterization of Chimerenonic RNAs: To assign putative functions to the RNAs chimmerized by GDH, cDNA sequences were used as queries to search the NCBI nucleotide-nucleotide (including ESTs) BLAST (blastn), and non-redundant protein translation (blastx) databases [9]. Putative functions were assigned to alignments with the highest scores. To study sequence homologies among the GDH-chigrammed RNAs, the NCBI BLASTN 2 Sequences alignment algorithm was used [10].

2.6 Northern Blot Analysis: Total RNA was extracted from the control and mineral salt-treated peanuts using the acidic phenol/chloroform method [11]. Equal amounts (10 µg) of total RNAs and chimerenomic RNAs chigrammed by the GDH charge isomers of the control and treated peanuts were loaded on 2% (w/v) glyoxal-agarose gels, electrophoresed, and then photographed to verify RNA quality and to ensure that samples were equally loaded. RNA was electro-transferred from the agarose gel (Trans-Blot SD cell of Bio-Rad, Hercules, CA) onto Brightstar-Plus nylon membranes (Ambion, Austin, TX, USA) and immobilized to the membrane by oven heating at 85 ⁰C for 2h. Electro-transfer from the gel was repeated onto a second Brightstar-Plus nylon membrane and processed together with the first membrane to verify completeness of transfer of RNA from the gel. 

            For the preparation of DNA probes, cDNA inserts were amplified by PCR from the corresponding plasmids (10 ng) using T7 forward and T3 reverse primers (1 µM each), [α³²P]dATP (3000 Ci/mmol, 10 mCi/mL, 2 µL), dCTP/dGTP/TTP mix (50 mM, 2 µL), Taq polymerase (1 U), in a final volume of 20 µL. Amplification was for 35 cycles (95 ⁰C for 60 seconds, 55 ⁰C for 30 seconds, and 72 ⁰C for 60 seconds), followed by final extension incubation at 72 ⁰C for 10 min. Unincorporated nucleotides were removed from the labeled cDNA inserts by chromatography through short column of Sephadex G50 [12, 13].

            Membranes with immobilized RNAs were prehybridized with ULTRAhyb buffer (Ambion, Austin, TX, USA) at 68 ⁰C for 30 min and hybridized with ³²P-labeled cDNA inserts as probes overnight at 68 ⁰C. The membranes were washed (15 min, 42 ⁰C) followed by another wash (15 min, 68 ⁰C) with NorthernMax low stringency wash solution (Ambion, Austin, TX, USA) to remove unbound probes. The blot was exposed to X-ray film with intensifying screens at -80 ⁰C for autoradiography. The band intensities were digitalized using UN-SCAN-IT gel digitizing software (Silk Scientific, Inc., Orem, Utah, USA).

            Northern analysis with each labeled cDNA of GDH-chigrammed RNA probe was carried out in duplicate with a second agarose gel loading of RNA preparations to verify reproducibility of results [12, 13].

.

2.7 Chemical Synthesis and Labeling of Oligonucleotide Probes

The homologous section of each GDH-synthesized RNA was clipped out of the non-homologous 3’-, and 5’-termini, and the complementary strand of the oligonucleotide was chemically synthesized by Sigma Life Science, The Woodlands, Texas, USA. The oligonucleotide (1.0 pmol) was labeled with 1 µL of [Ɣ³²P] ATP (7000 Ci/mmol) (ICN Biochemicals, OH, USA) using I µL of T4 polynucleotide kinase (Kinase-Max kit, Ambion, Austin, TX, USA) (10 units/µL) and 2 µL 10× Kinase buffer added to the reaction cocktail to bring the total volume to 20 µl with molecular biology quality water. Reaction was incubated at 37˚C for 1 h and stopped by adding EDTA to make the reaction 1 mM, then heated to 95˚C for 3 min. Excess unreacted [³²P] ATP was removed by chromatography of the reacted solution through Ambion NucAway spin column.

3.0    Results and Discussion

3.1 Chimerenomic Northern Blot. Chimerenomic RNA enzyme degrades total RNA in vitro and in vivo [1, 13]. Therefore, the scientific logic of these research projects on the selective degradation of superfluous genetic code-based RNAs is that the labeled first cDNA strand of the nongenetic code-based (GDH-chimmerized) RNA hybridizes (base-pairing) to and links the chimerenomic (nongenetic code-based) RNA directly to its target homologous mRNA in total RNA (genetic code-based RNA), thus serving as a failproof method for confirming the presence or absence of the Northern bands of the specific mRNAs on the Northern blots. The presence of a target mRNA band on Northern blot confirms it is not an abnormal genetic code-based RNA; whereas the absence therefrom confirms it is a superfluous genetic code-based RNA having been degraded in vivo by chimerenomic RNA enzyme induced by the changes of the environmental conditions where the peanut was cultivated. Northern blot results (Figures 1 – 9) visually illuminate this chimerenomic science and explain how nongenetic code-based NTinti RNA enzyme distinguishes superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter.

            The Northern probe nucleotide sequences (Table 2A) selected for this study had been identified as optimizers of peanut seed nutritious and biomass yields [1, 4, 5, 13, 14].

3.2 The NPKS-treated Peanut

            Northern bands of different densitometric intensities were obtained (Figure 1) for the mRNAs encoding phosphate translocator, granule-bound starch synthase, GARS/GART, phosphoglucomutase, and glucosyltransferase. Total RNA Northern band in the over-size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided tissue-specific environmental protection labels for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for inorganic phosphate translocator, granule-bound starch synthase, phosphoglucomutase, glucosyltransferase and GARS/GART were present in the stoichiometric ratios of 6:2:1:1:4 respectively. Based on the wide stoichiometric ratios of the surviving mRNAs, the mechanism by which nongenetic code-based NTinti RNA

Figure 1: The NPKS-treated Peanut. Environment/Tissue specific protection of the normal mRNAs encoding (a) phosphate translocator, (b) granule-bound starch synthase, (c) phosphoglucomutase, (d) glucosyltransferase, and (e) GARS/GART by nongenetic code-based RNA enzyme in NPKS-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel purified; and total RNA isolated from the same NPKS-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were transblotted onto nylon membranes followed by membrane screening with ³²P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed. Only normal mRNAs identified in the electrochemical gradients of homologous chimerenomic RNA enzymes were allowed de novo transcriptional production.

enzyme distinguishes superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter is that when a magnetoelectric change occurs in the environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing superfluous mRNAs of the previous environment, and then allows the de novo transcription of only normal mRNAs to take place. In that way, the new NTinti RNA enzyme degraded all the superfluous/abnormal mRNAs, and reduced the normal mRNA levels for phosphoglucomutase, glucosyltransferase and granule-bound starch synthase to the lowest minimum stoichiometric (reacting molar quantities) ratios.

The enforcement of the reacting quantities of genetic code-based RNAs to comply with molar (stoichiometric) ratios is scientifically important because chemical reactions occur in whole number ratios between the reactants not only in vitro but also in vivo. When genetic code-based RNAs are not present in their stoichiometric ratios, chimerenomic NTinti RNA enzyme recognizes them as superfluous, unnecessary, abnormal and wasteful expenditure of cellular energy; and spontaneously degrades them.

            In the experimentations, the chimerenomic RNAs were chigrammed by the same GDH charge isomers of the same NPKS-treated peanut seeds; the total RNA was purified from the same peanut seeds; the only variable being the different chimerenomic RNA probes that were homologous to the respective mRNAs thus validating the comparative analyses applied to explain the Northern blot results.

            In the series of chimerenomic research projects, this was one of the 80 projects, each project comprising of four experiments in duplicate repeats (total of 640 discrete experiments) that established the quadrilateral crisscrossing research protocols [1; 2] of the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme could offer the hope of total cure for human health disorders caused by dysfunctional genetic code (Figures 10, 11).

3.3 The PK-Treated Peanut

Northern bands of different densitometric intensities were obtained (Figure 2) for the mRNAs encoding granule-bound starch synthase, phosphoglucomutase, glucosyltransferase, GARS/GART, and nitrate reductase. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment-specific identification protection for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for starch synthase, phosphoglucomutase, glucosyltransferase, GARS/GART, and nitrate reductase were present in the stoichiometric ratios of 6:2:1:10:1 respectively. Based on the wide stoichiometric ratios of the surviving mRNAs (Figure 2), the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous/dysfunctional genetic code-based RNA from normal genetic code-based RNA, degrading the former and sparing the latter is that when a physicochemical change occurs in the environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing mRNAs of the previous environment, and then allows the de novo transcription of only the normal genetic code-based RNAs. In that way, the new NTinti RNA enzyme degraded all the superfluous, abnormal unnecessary mRNAs for phosphoglucomutase, glucosyltransferase, and nitrate reductase; and minimized their normal mRNAs to the lowest stoichiometric (reacting molar quantities) ratios (Figure 2).

Figure 2: The PK-treated Peanut. Environment/Tissue specific protection of the normal mRNAs encoding (a) granule-bound starch synthase, (b) phosphoglucomutase, (c) glucosyltransferase, (d) GARS/GART, and (e) nitrate reductase by nongenetic code-based RNA enzyme in PK-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel purified; and total RNA isolated from the same PK-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were transblotted onto nylon membranes followed by membrane screening with ³²P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed. Only mRNAs protected by the electrochemical gradients of homologous chimerenomic RNA enzymes were allowed to be produced by de novo transcription.

            In the experimentations (Figure 2), the chimerenomic RNAs were chigrammed by the same GDH charge isoenzymes of the same PK-treated peanut seeds; the total RNA was purified from the same PK-peanut seeds; the only variable being the chimerenomic RNA probes that were homologous to the respective mRNAs thus validating the comparative analyses applied to explain the Northern blot results.

            In the series of chimerenomic research projects, this was one of the 80 projects that established the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme could offer hope of total cure for some human health ailments.

3.4 The Sodium Phosphate-treated Peanut

Northern bands of different densitometric intensities were obtained (Figure 3) for the mRNAs encoding phosphoglucomutase, glucosyltransferase, acetyl CoA carboxylase, GARS/GART, and NADH-GOGAT. Total RNA Northern band in the over-size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also, present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment-specific identification labels for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for phosphoglucomutase, glucosyltransferase, acetyl CoA carboxylase, GARS/GART, and NADH-GOGAT were present in the stoichiometric ratios of 10:3:2:4:6 respectively. Based on the wide stoichiometric ratios of the surviving mRNAs (Figure 3), the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous/abnormal genetic code-based RNA from normal genetic code-based RNA, degrading the former and sparing the latter is that when a magnetoelectric change occurs in the environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing dysfunctional mRNAs of the previous environment, and then allows the de novo transcription of only normal genetic code-based RNAs. In that way, the new NTinti RNA enzyme degraded all the mRNAs for glucosyltransferase, acetyl CoA carboxylase, and NADH-GOGAT; and limited their normal mRNA transcriptions to the lowest stoichiometric ratios of 1:1:1 respectively (Figure 3).

Figure 3: The Sodium Phosphate-treated peanut. Environment/Tissue specific protection of the normal mRNAs encoding (i) phosphoglucomutase, (ii) glucosyltransferase, (iii) acetyl CoA carboxylase, (iv) GARS/GART, and (v) NADH-GOGAT by nongenetic code-based RNA enzyme in inorganic phosphate-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel-purified; and total RNA isolated from the same phosphate-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with ³²P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed.

.

          In the experimentations (Figure 3), the chimerenomic RNAs were chigrammed by the same GDH charge isomers of the same phosphate-treated peanut seeds; the total RNA was purified from the same phosphate-treated peanut seeds; the only variables were the mRNA probes that were homologous to the different chimerenomic RNAs thus validating the comparative analyses applied to explain the Northern blot results.

            In the series of chimerenomic research projects, this was one of the 80 projects that established the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme could offer hope of total cure for human health ailments caused by dysfunctional genetic code.

3.5 The PN-treated Peanut

            Northern bands of similar densitometric intensities were obtained (Figure 4) for the mRNAs encoding phosphate translocator, and granule-bound starch synthase. Total RNA Northern band in the over-size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment-specific labels for each genetic code-based mRNA target. Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for inorganic phosphate translocator, and granule-bound starch synthase were present in the stoichiometric ratios of 1:1. The low and equal stoichiometric ratio of the two mRNAs confirmed the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous/abnormal genetic code-based RNA from normal RNA, degrading the former and sparing the latter is that when the PN physicochemical change occurred in the environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing mRNAs of the previous environment, and then allowed the de novo transcription of only normal mRNAs. In that way, the new NTinti RNA enzyme degraded all the superfluous/abnormal mRNAs for phosphate translocator, and granule-bound starch synthase and reduced their normal mRNA concentrations to the lowest minimum stoichiometric ratio of 1:1 (Figure 4).

Figure 4: The PN-treated peanut. Environment/Tissue specific protection of the normal mRNAs encoding (a) phosphate translocator, and (b) granule-bound starch synthase by nongenetic code-based RNA enzyme in PN-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel purified; and total RNA isolated from the same PN-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with ³²P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed.

          In the experimentations, the chimerenomic RNAs were chigrammed by the same GDH charge isomers of the same PN-treated peanut seeds; the total RNA was purified from the same PN-treated peanut seeds; the only variables were the probes for the mRNAs that were homologous to the different chimerenomic RNAs thus validating the comparative analyses applied to explain the Northern blot results.          

3.6 The Sodium Sulfate-treated Peanut

            Northern bands of different densitometric intensitiess were obtained (Figure 5) for the mRNAs encoding phosphate translocator, nitrate reductase, and GARS/GART. Total RNA Northern band in the over-size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment-specific identification labels for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for inorganic phosphate translocator, nitrate reductase, and GARS/GART were present in the stoichiometric ratios of 6:1:3 respectively. Based on the wide stoichiometric ratios of the surviving mRNAs, the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter is that when a magnetoelectric change occurs in the environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing superfluous mRNAs of the previous environment, and then allows the de novo transcription of only normal mRNAs to take place. In that way, the new NTinti RNA enzyme degraded all the superfluous/alternatively spliced mRNAs for nitrate reductase, and GARS/GART, and reduced their normal mRNA to the lowest minimum stochiometric ratio of 1:3 (Figure 5).

            In the experimentations (Figure 5), the chimerenomic RNAs were chigrammed by the same GDH charge isomers of the same sulfate-treated peanut seeds; the total RNA was purified from the same sulfate – treated peanut seeds; the only variables were the chimerenomic RNA probes that were homologous to the different mRNAs thus validating the comparative analyses applied to explain the Northern blot results.

In the series of chimerenomic research projects, this was one of the 80 projects that established the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme as drug could offer the hope of total cure for some human health disorders.

Figure 5: The Sodium Sulfate-treated peanut. Environment/Tissue specific protection of the normal mRNAs encoding (a) phosphate translocator, (b) nitrate reductase, and (c) GARS/GART by nongenetic code-based RNA enzyme in sodium sulfate-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel-purified; and total RNA isolated from the same sulfate-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with ³²P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed.

3.7 The NS-treated Peanut

Northern bands of different densitometric intensities were obtained (Figure 6) for the mRNAs encoding phosphoglucomutase, acetyl CoA carboxylase, and nitrate reductase. Total RNA Northern band in the 0ver-size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment-specific identification labels for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for inorganic phosphoglucomutase, acetyl CoA carboxylase and nitrate reductase were present in the stoichiometric ratios of 4:1:3 respectively. Based on the wide stoichiometric ratios of the surviving mRNAs, the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter is that when a magnetoelectric change occurs in the environment, and if there is excess NTinti RNA produced, the new NTinti RNA enzyme spontaneously degrades all the pre-existing unnecessary mRNAs of the previous environment, and then allows the de novo transcription of only normal mRNAs to take place. In that way, the new NTinti RNA enzyme degraded all the superfluous/abnormal mRNAs for acetyl CoA carboxylase and nitrate reductase and reduced their normal mRNA to the lowest minimum stochiometric ratio of 1:3 (Figure 6).

            In the experimentations (Figure 6), the chimerenomic RNAs were chigrammed by the same GDH charge isomers of the same NS-treated peanut seeds; the total RNA was purified from the same NS–treated peanut seeds; the only variables were the chimerenomic RNA probes that were homologous to the different mRNAs thus validating the comparative analyses applied to explain the Northern blot results.

            In the series of chimerenomic research projects, this NS – treated peanut was one of the 80 projects that established the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme as drug could offer the hope of total cure for human health disorders caused by dysfunctional genetic code.

Figure 6: The NS-treated peanut. Environment/Tissue specific protection of the normal mRNAs encoding (a) phosphoglucomutase, (b) acetyl CoA carboxylase, and (c) nitrate reductase by nongenetic code-based RNA enzyme in NS-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel-purified; and total RNA isolated from the same NS-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with ³²P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed.

3.8 The Ammonium chloride – treated Peanut

Northern bands of different densitometric intensities were obtained (Figure 7) for the mRNAs encoding phosphate translocator, granule-bound starch synthase, phosphoglucomutase, and glucosyltransferase. Total RNA Northern band in the over-size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment/tissue-specific identification labels for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for phosphate translocator, granule-bound starch synthase, phosphoglucomutase, and glucosyltransferase were present in the stoichiometric ratios of 3:2:1:2 respectively. Based on the narrow stoichiometric ratios of the surviving mRNAs (Figure 7), the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous genetic code-based RNA from normal genetic code-based RNA, degrading the former and sparing the latter is that when a magnetoelectric change occurs in the environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing abnormal mRNAs of the previous environment, and then allows the de novo transcription of only normal genetic code-based RNAs to take place. In that way, the new NTinti RNA enzyme degraded all the superfluous mRNAs for granule bound starch synthase, phosphoglucomutase, and glucosyltransferase; and limited their normal mRNA transcriptions to the lowest stoichiometric ratios of 2:1:2 respectively (Figure 7).

            In the experimentations (Figure 7), the chimerenomic RNAs were chigrammed by the same GDH charge isoenzymes of the same ammonium chloride – treated peanut seeds; the total RNA was purified from the same ammonium chloride–treated peanut seeds; the only variables were the mRNA targets that were homologous to the different chimerenomic RNA probes thus validating the comparative analyses applied to explain the Northern blot results.

In the series of the peanut chimerenomic research projects, this ammonium chloride - treated peanut was one of the 80 projects that established the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme could offer hope of total cure for some human health ailments.

Figure 7: The Ammonium Chloride-treated peanut. Tissue/environment-specific protection of normal mRNAs encoding (a) phosphate translocator, (b) granule-bound starch synthase, (c) phosphoglucomutase, and (d) glucosyltransferase by nongenetic code-based RNA enzyme in ammonium chloride-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel-purified; and total RNA isolated from the same ammonium chloride-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with ³²P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed.

3.9 The PS – treated peanut

Northern bands of different densitometric intensities were obtained (Figure 8) for the mRNAs encoding phosphate translocator, and phosphoglucomutase. Total RNA Northern band in the size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment-tissue specific identification labels for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the two mRNAs were present in the stoichiometric ratio of 1:1. Based on the equal stoichiometric ratio of the surviving mRNAs, the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter is that when a magnetoelectric change occurs in the

Figure 8: The PS-treated peanut. Tissue/environment-specific protection of the normal mRNAs coding (a) phosphate translocator, and (b) phosphoglucomutase, by nongenetic code-based RNA enzyme in PS-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel-purified; and total RNA isolated from the same PS-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with ³²P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed. Only mRNAs protected by the electrochemical gradients of homologous chimerenomic RNA enzymes were allowed to be produced by de novo transcription. Any mRNAs/genetic code-based RNAs lacking the protective gradient of electrochemical homologous chimerenomic RNA enzymes were identified as superfluous/abnormal and degraded.

environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing dysfunctional mRNAs of the previous environment and then allows the transcription of only normal mRNAs to take place. In that way, the new NTinti RNA enzyme degraded all the superfluous mRNAs for phosphate translocator, phosphoglucomutase and reduced their normal mRNA to the lowest minimum stochiometric ratio of 1:1 (Figure 8).

            In the experimentations (Figure 8), the chimerenomic RNAs were chigrammed by the same GDH charge isoenzymes of the same PS -treated peanut seeds; the total RNA was purified from the same PS – treated peanut seeds; the only variables were the cDNAs of chimerenomic RNA probes that were homologous to the different target mRNAs thus validating the comparative analyses applied to explain the Northern blot results.

            In the series of chimerenomic research projects, this PS – treated peanut was one of the 80 projects that established the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme as drug could offer the hope of total cure for some human health disorders.

3.10 The Control peanut

The control peanut’s mRNAs encoding phosphate translocator protein, phosphoglucomutase, and nitrate reductase did not give Northern bands (Figure 9). Also, absent were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment/tissue identification labels for every genetic code-based RNA Northern band so far observed in all of the other treated peanuts. This is to highlight the known chimerenomic concept that the control organism is a treated organism but the treatment’s contents and composition are unknown [14]. In this regard, it is just appropriate to recognize that the interactions of the control peanut with the soil physics (environment) to induce the unique physicochemical changes on the peanut GDH was dissimilar to the mineral salt-treated peanuts. Essentially, the GDH of the control peanut was not the control GDH [14].

Therefore, every genetic code-based RNA has a cascade of homologous nongenetic code-based   RNAs that identifies it in the Northern blots (Figures 1-9). When the magnetoelectric change occurred in the environment of the Control peanut, the new chimerenomic RNA enzymes that were produced degraded all the pre-existing abnormal mRNAs of the previous environment but then did not allow the transcription of normal mRNAs encoding phosphate translocator, phosphoglucomutase, and nitrate reductase to resume. This is a major difference that suggests all the pre-existing mRNA for phosphate translocator, phosphoglucomutase, and nitrate reductase of the control peanut were abnormal and/or superfluous.

The other difference in the control peanut’s Northern blots (Figure 9) was that the homologous nongenetic code-based chimerenomic RNAs that identified the unique environment/tissue interactions were patchy discontinuous cascades unlike the continuous chimerenomic NTinti RNA electrochemical gradient formations witnessed in the Northern blots for the mineral salt-treated peanuts (Figures 1-8).

            The differences explain how nongenetic code-based NTinti RNA enzyme distinguishes superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter, as follows:

A.1. The continuous chimerenomic NTinti RNA electrochemical gradient cascade formations were created by more than thousands of nucleotide sequence matches between the normal genetic code-based RNAs (mRNA, rRNA, tRNA, precursor RNA etc) and the chimerenomic RNAs chigrammed by the GDH charge isomers.

A.2. The number total of the thousands of nucleotide sequence matches was the tissue/environment-specific signaling to spare the normal genetic code-based RNA from chimerenomic NTinti RNA enzyme’s magnetoelectric destruction. This is the chemical basis of the tissue specificity of NTinti chimerenomic RNA enzyme activity.

B.1 The discontinuous and patchy cascades of the homologous nongenetic code-based RNAs that identified the unique environment/tissue interactions in the control peanut were created by the less than a hundred nucleotide sequence matches between the superfluous genetic code-based RNAs (mRNA, rRNA, tRNA etc) and the chimerenomic RNAs chigrammed by the GDH charge isomers.

Figure 9: The Control Peanut. Tissue/environment-specific signaling that led to the degradation of superfluous mRNAs encoding (a) phosphate translocator, (b) phosphoglucomutase, and (c) nitrate reductase by nongenetic code-based RNA enzyme in the control peanut.  Northern bands were not produced by the indicated mRNAs. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel-purified; and total RNA isolated from the same control peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with ³²P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed. Only mRNAs protected by the electrochemical gradients of homologous chimerenomic RNA enzymes were allowed to be produced by de novo transcription. Accordingly, the abnormal/superfluous mRNAs encoding (a) phosphate translocator, (b) phosphoglucomutase, and (c) nitrate reductase were not protected by electrochemical gradients of homologous chimerenomic RNA enzymes.

B.2. The number total of the less than a hundred nucleotide sequence matches was the tissue/environment-specific signaling for the superfluous genetic code-based RNAs (mRNAs, rRNAs, tRNAs etc) to get degraded by chimerenomic NTinti (nongenetic code-based) RNA enzyme.

These graphical details about the NTinti’s control of gene expression have medical implications in how to cure human health disorders. Genetic and genomic medicine could not capture these cinematographic moments (Figures 1-9) in the regulation of DNA gene expression.

This is a novel, and indeed a phenomenal environment-guided physicochemical description of the regulation of DNA gene expression because it is nongenetic code-based NTinti RNA enzymes that abolish (silence) superfluous/abnormal genetic code-based RNAs. Many examples of the silencing of DNA gene expression were observed in the crisscrossing network of controls in these 80-fold chimerenomic research projects on peanut’s GDH [14].

            Superfluous genetic code-based RNAs may now be redefined and expanded to include those transcribed in gross weight quantities outside of the ratios of stoichiometric needs of the cell’s biochemical reactions, mutated genetic code-based RNAs, alternatively spliced genetic code-based RNAs, abnormal/dysfunctional genetic code-based RNAs, and externally introduced genetic code-based RNAs.

4.0    Dissecting Genetic Disorders at the Sub-molecular Levels.

 In the series of 80-fold chimerenomic research projects, we added Northern blotting in the tool kit of the science of chimerenomic chemistry to unfold it as a preclinical research discipline – how chimerenomic NTinti RNA enzyme could offer a hope of total cure for many human health disorders caused by dysfunctional genetic code. Genetics and genomics have accomplished a remarkable advancement in therapeutic medicine by structuring primary medical care to depend on the properties of the genetic code. Nongenetic code-based chimerenomic biology is ushering in a new era of rapid advancements in the treatment of human diseases. By exploring the underlying causes at a sub-molecular level, we are gaining unprecedented insights that have the potential to transform medical approaches and enhance therapeutic options.

            GDH redox cycle hexameric isoenzymes chigram minus nucleotide sequences and plus nucleotide sequences simultaneously and seamlessly to produce the single-stranded macromolecular NTinti chimerenomic (nongenetic code based-based) RNA enzyme [15], that degrades abnormal and/or superfluous genetic code based-RNA, thus regulating gene expression [1]. Therefore, the presence of plus RNA and minus RNA in the same nongenetic code-based RNA strand instead of in two separate opposite polarity strands of genetic code-based RNA, and application of the cDNA of nongenetic code-based RNA as Northern probes for genetic code-based RNAs is a historical change-making development in genetics because it has allowed chimerenomic chemistry to dive deeper below the molecular level of the gene to its sub-molecular strata (Figures 1-9). The bold Northern bands are cinematographic, and allude to strong base pairing reactions between genetic code-based RNA, nongenetic code-based RNAs, and the two strands of the cDNA probes. The bold Northern bands were evidence that more than two strands of the probe hybridized to the same molecule of genetic code-based RNA, thus making it possible to decipher the sub-molecular chemical mechanism by which the NTinti chimerenomic RNA enzyme selected and degraded the superfluous genetic code-based RNAs, but spared the normal genetic code-based RNAs. The chimerenomic bioinformatics database sequence comparison tool, and the blast 2 nucleotide sequence [10] analysis for the mRNAs versus the chimerenomic RNA probes showed numerous +/+, -/-, -/+, and +/- matches at the sub-molecular level of the mRNAs that could enhance the degradation of the dysfunctional mRNA in an environment of chimerenomic RNA-based therapy. The bold Northern bands (Figures 1-9) showed that genetic code-based RNAs (mRNAs, rRNAs, precursor RNAs, tRNAs, long noncoding RNAs etc) are composite and complex biomolecules in their origin. Therefore, had the traditional genomics-based Northern blot procedure involving the use of genetic code-based probe to match genetic code-based RNAs via quantitative PCR, the projects would have failed to detect the differences between the hybridization of the probe to superfluous RNA and normal genetic code-based RNAs.

4.1 Conversion of magnetoelectric changes of the environmental condition to chimerenomic nongenetic code-based RNA enzyme by the hexameric isoenzymes of GDH: Whereas Figures 1 – 9 demonstrate the base pairing hybridization at the sub-molecular level  between the mRNAs, the cDNAs of the homologous chimerenomic nongenetic code-based RNA Northern probes, and the chimerenomic nongenetic code-based RNAs chigrammed by the corresponding GDH charge isomers, the conversions of the magnetoelectric changes of the environment by the GDH hexameric isoenzyme populations to arrays of chimerenomic nongenetic code-based RNAs is demonstrated in Figure 10.     

The hexameric GDH isoenzyme distribution pattern changed from that of the Control peanut upon treatment of the peanut plants with mineral salts solutions (Figures 10a – 10j). Each GDH distribution pattern was unique to its changed environmental condition and different from that of the other peanuts. The GDH₁ and GDH₂ nonallelic gene structure [8] with the gene (GDH)₁ encoding the more acidic subunits (α, and a) being heterozygous and co-dominant; and the gene (GDH₂), encoding the less acidic subunit (b) being homozygous explain the isoenzyme populations in Figure 10.   The characteristic 7-10 charge isomers in the Figure suggest the statistical binomial hexameric subunit structure (a, α, and b) to give 28 hexameric isoenzymes in Figure 11 based on the codominant allelic forms of gene GDH₁ which controls the synthesis of the two subunits (a, and α), as known for many plants. The experimentally derived populations (Figures 10a – 10j) resemble the binomial statistical distribution (Figure 11) but there were deviations caused by the interplay between nucleophilicity and concentration of the mineral salt ions (electromagnetic nucleophiles). The GDH hexameric isoenzyme distribution patterns induced by the control, NPKS, K, sulfate, PS, and PK deviated the most from the theoretical binomial pattern.

            The catalytic mechanism of GDH involves chimmerization of an enzyme-linked Schiff base intermediate between the carbonyl group of α-KG and the ε-amino group of the Lys residue in the active site of the enzyme [16] to form the initiation complex. The Schiff base nitrogen is protonated at neutral pH. The strong electron withdrawing property of the protonated nitrogen so formed predisposes the site to nucleophilic attack. Therefore, the Schiff base readily undergoes alternative nucleophilic reactions depending on the nucleophilicity and concentration of prevalent nucleophiles. Attack by weak nucleophiles (water, ammonium ion etc) release the ε-NH₂ group of the Lys residue, breaking the Schiff bond, and liberating the undegraded GDH polypeptide. But the Schiff base could be attacked by strong nucleophiles (K⁺, SO₄^2-, PO₄^3-, nitrile etc) to form GDH-linked substituted imine complexes that are stable. Ultimately, such modified GDH subunits (dead-end complexes) are degraded because inactivated enzymes are removed by degradation [16]. The deviation from the binomial statistical pattern of the GDH isoenzyme population in the Control, NPKS-treated, KCl-treated, sulfate-treated, PS-treated, PK-treated peanuts (Figure 10) is a consequence of the degradation of the inactivated GDH subunit polypeptides via GDH-linked mineral ion imine complexes. This is the biochemical basis of the differential responses of GDH to nucleophiles [8; 15; 16] including opioids [2].

The demonstration of the conversion of the magnetoelectric changes of the environmental conditions to nucleotide sequence of chimerenomic (nongenetic code-based) RNA enzyme (Figure 10), and linking their activity directly and visually to the degradation of individual mRNA molecules (superfluous/abnormal genetic code-based RNA) in vivo at the sub-molecular level (Figures 1-9) marks the moment of the conquest of hitherto inexplicable human health disorders through human scientific/technological ingenuity.

4.2.0 The Functions of the Segments of Chimerenomic RNAs

When the homologous section of each chimere (GDH-synthesized RNA) was clipped out of the non-homologous 3’-, and 5’-termini, and the complementary strand of the oligonucleotide was labeled and applied as Northern probe (Table 2 B), no Northern bands were produced. Therefore, chimere has three segments which is another unique characteristic that differentiates chimerenomic RNAs from non-chimerenomic RNAs (genetic code-based RNAs such as mRNA, tRNA, rRNA, siRNA, miRNA, lncRNA, shRNA, etc.). Therein lies the functional attributes of the RNA segments.

All active chimerenomic RNAs have chimeres, the active part of the chimerenomic RNA enzyme that participates in specific non-chimerenomic (genetic code-based) RNA degradation. Furthermore, all chimeres have three specific segments with unique functions: the middle homologous segment of chimerenomic RNAs is flanked at both ends by specific non-homologous segments. Therefore, a typical chimere has a 3’ end, then the homologous middle, and then a 5’ end. Whereas the middle homologous segment possesses homologous sequences that align to a particular non-chimerenomic RNA, the 3’ and 5’ ends serve as the segments with the unique sequences that guide the chimerenomic RNA to its target non-chimerenomic RNA for homology to occur. These 3’ and 5’ ends also protect the homologous middle segment of chimerenomic RNA from binding indiscriminately to random non-chimerenomic RNA until it reaches its destined target non-chimerenomic RNA. Thus, these 3’ and 5’ ends serve as a kind of “antenna” that confers specificity on the chimere, helping it to distinguish superfluous mRNAs from normal mRNAs (genes), degrading the former and sparing the latter. The specificity conferred on these chimerenomic RNA antennas is environmental in origin. The environmental changes that get electromagnetically converted to chimerenomic RNAs impose these specific 3’ and 5’ end (antenna) signals that guide the chimerenomic RNAs to their destination, conferring specificity and the ability to differentiate between superfluous and normal non-chimerenomic RNAs. The role of the 3’ and 5’ ends has been studied extensively in chimerenomic research experiments [13].

Importantly, Chimerenomic RNA does not degrade another chimerenomic RNA from the same species within the same environmental change. It is the antenna that enables them to recognize themselves, and it is also the antenna that enables them to recognize non-chimerenomic RNAs, distinguishing superfluous ones from normal ones.

Factors such as G+C content, genetic-induced steric hindrance, varying electromagnetic charges, and differing electrostatic and magnetoelectric energies aid chimerenomic RNAs in precisely targeting non-chimerenomic RNAs.

4.2.1 Target Specificity of Chimerenomic RNA Enzyme  Activity

The chimerenomic probes lacking the 5’-. and 3’- terminal flanking nonhomologous nucleotide sequences (Table 2 B) were applied as Northern probes to screen peanut total RNA and chimerenomic RNAs synthesized by the GDH charge isomers as was done in Figures 1 – 9 with the complete chimerenomic RNA probes (Table 2 A). Northern bands were not produced when the chemically synthesized probes lacking the 5’-, and 3’- terminal flanking nonhomologous nucleotide sequences (Table 2 B) were applied as Northern probes.

Failure of the chemically synthesized oligonucleotide to produce Northern bands has several consequences and implications in genetic code-based biology, disease-tissue-gene targeting pharmaco-dynamic assay protocols, and molecular medicine because genetic code-based medicine does not possess this level of pharmacokinetic accuracy. The 5’-, and 3’- terminal flanking nonhomologous nucleotide sequences have added a new dimension to how nongenetic code-based NTinti RNA enzyme distinguishes superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter.

When a new environmental change occurs, a paradigm shift takes place in the chimerenomic RNAs produced, with new homologous sequences and new 3'- and 5'- ends that are signatures of that new environment. The new chimerenomic RNA, using specificity conferred by its 3'- and 5'- ends, seeks out the total RNAs of the old or preceding environment (which have become superfluous) and degrades them, as demonstrated in Figures 1 to 9 above. After degradation, the cells are triggered to start producing new genetic code-based total RNAs that reflect the new environment, thus reprogramming the cell's metabolism to survive the environmental change that occurred in the first place. It is believed that the 3'- and 5'- ends are the triggers that cause the genes to produce the new environment's population of genetic code-based total RNAs, which will be spared from degradation.

These functions confer immense specific and spatial ability on chimerenomic RNAs to regulate gene expression and gene silencing, potentially conferring metabolic pluripotency and totipotency on any cell in a controlled stoichiometric nucleophile environment. The complex functions of chimerenomic RNA are at the sub-molecular level, exhibiting various spectra of control over genes.

The implications of these findings for pharmacology, medicine, and disease prevention and treatment are far-reaching. An active pharmacologic agent (APA) is a nucleophile, and when it is exposed to cells (a change in environment), it causes the production of chimerenomic RNA, which in turn regulates sets of mRNAs that temporarily reprogram the cell's metabolism, be it through modified protein enzyme synthesis, protein channel control, ion channel control etc. The result is a pharmacological effect. However, active pharmacologic agents are also chemicals with direct toxic properties to biological cells and tissues, which limit their safety profile, and many of them cause more harm than good. Chimerenomic principles of medicine are on course to change pharmacology as we know it, eliminating adverse drug effects and harnessing only their useful actions.

This procedure has been carried out by Osuji and Okea [1, 2, 3, 15, 17, 18, 19, 20, 21] in chimerenomic RNA pharmacology using astrocyte cells. An active pharmacological agent (morphine), a new environment, was applied to growing astrocyte cell cultures. After days 9 and 11, the cells were harvested, and the chimerenomic RNAs at various concentrations of morphine were chigrammed by a special technique, yielding large NTinti RNA enzymes that have become a new pharmacological entity for the reprogramming of morphine-addicted astrocytes in vitro and in vivo. This extreme innovation is groundbreaking. By changing the environment with the active pharmacologic agent, we captured the change in chimerenomic NTinti RNA sequences: a new pharmacologic agent is born, and a new way of producing drugs is born. These new drugs will have no safety constraints compared to the direct exposure of the living cells and tissues of the body to the active pharmacologic agent. This is the future of pharmacology and medicine, an intricate molecular pharmacology tapestry only possible with chimerenomic sciences.

Figures 1 to 9 are also examples of how new drug efficacy and target specificity can be studied in the new chimerenomic pharmacology.

The environmental reprogramming principles of chimerenomic medicine can be used to program cells and alter the natural history of many disease conditions, opening opportunities to prevent, treat and reverse diseases such as Parkinson's disease and Alzheimer's dementia, as well as aging and age-related cell death.

4.2.2   Non-Watson-Crick and Non-Canonical Base-Pair Formation

Failure of the chemically synthesized oligonucleotide to hybridize to the target total RNA sequence is evidence that base pairing hydrogen bonding is not the chemical mechanism of alignment and degradation of total RNA by GDH-Chigrammed RNA. The alignment of GDH-Chigrammed RNA to the target genetic code-based RNA is by homologous sequence interaction, involving non-canonical base-pair formation between the two kinds of RNA. Non-Watson Crick base pairs of the types AA, UU, GG, CC, AU, GU etc that are involved in homologous sequence alignment also include van der Waals, electrostatic, and solvation terms that are known to stabilize RNA structural motifs and their helix arrangements [13]. However, the non-canonical base-pair formation in homologous RNA alignment is weaker than Watson Crick complementary hydrogen bonds, thus explaining the choice of low temperatures that were applied in the in vitro degradation of total RNA by GDH-Chigrammed RNA. Therefore, degradation of total RNA by non-genetic code-based RNA (GDH-Chigrammed RNA) confirms the nucleic acid chemistry [13]. Furthermore, double-stranded RNAs (miRNA, siRNA, shRNA etc), RISH and RITS protein complexes that dominate RNA interference mechanisms [13] were not involved in the GDH-Chigrammed RNA machinery. Homology-dependent gene silencing has been described [13] but it focused on transgenes without explaining the chemical mechanism of silencing. The fact that total RNA degradation fragments formed RNA | DNA hybrids suggested that the degradation mechanism was neither depurination nor depyrimidination of total RNA [13]

In the absence of the 3’- and 5’- ends, the homologous section of the chimerenomic RNAs fails to bind or interact with its’ target non-chimerenomic RNA (like mRNA), an indication that the 3’- and 5’- nonhomologous segments of chimere bears the specificity as well as the key for homology (non-canonical base-pair formation) to occur. Thus, the non-homologous 3’- and 5’- ends not only works as an antenna guiding the chimerenomic NTinti RNA to its’ targets, but they also function as a lock-and -key that ensures electrostatic interactions and alignment occurs before degradation of non-chimerenomic RNA happens. 

This non-Watson–Crick, non-canonical base pairing of chimerenomic RNAs is the key feature that distinguishes them from genetic code–based, non-chimerenomic nucleic acid chemistry, and becomes the divide between them. 

Figure 10: Responses of peanut GDH hexameric isoenzyme distribution patterns (a)-(j), and chimerenomic RNA arrays (i)-(x) chigrammed by the charge isomers to mineral treatments of peanut. M is RNA molecular weight marker; t is total RNA.

Control Peanut: Each GDH charge isomers in Figure 10a were made to convert the magnetoelectric change that occurred in the control peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10_i. Figure 10a showed that the Control peanut hexameric GDH isoenzymes deviated from that of the binomial statistical pattern (Figure 11), but all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10_i) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence.  Nongenetic code-based RNA array (Figure 10_i) was used for the Control peanut’s Northern blots (Figure 9).

 NPKS-treated Peanut: Each GDH charge isomers in Figure 10b were made to convert the magnetoelectric change that occurred in their NPKS-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10_ii. Figure 10b showed that the NPKS-peanut hexameric GDH isoenzymes deviated from that of the binomial statistical pattern (Figure 11), but all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10b) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence.  Nongenetic code-based RNA array (Figure 10_ii) was used for the NPKS-peanut’s Northern blots (Figure 1).

NS-treated Peanut; Each GDH charge isomers in Figure 10c were made to convert the magnetoelectric change that occurred in their NS-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10_iii. Figure 10c showed that the NS-treated peanut hexameric GDH isoenzymes resembled that of the binomial statistical pattern (Figure 11). Also, all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10_iii) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence.  Nongenetic code-based RNA array (Figure 10_iii) was used for the NS-treated peanut’s Northern blots (Figure 6).

Inorganic Phosphate-treated peanut: Each GDH charge isomers in Figure 10d were made to convert the magnetoelectric change that occurred in the Pi-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10_iv. Figure 10d showed that the Pi-treated peanut hexameric GDH isoenzymes resembled that of the binomial statistical pattern (Figure 11). Also, all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10_iv) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence.  Nongenetic code-based RNA array (Figure 10_iv) was used for the Pi-treated peanut’s Northern blots (Figure 3).

Sodium Sulfate-treated peanut: Each GDH charge isomers in Figure 10f were made to convert the magnetoelectric change that occurred in the sulfate-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10_vi. Figure 10f showed that the sulfate-treated peanut hexameric GDH isoenzymes deviated from that of the binomial statistical pattern (Figure 11), but all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10_vi) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence.  Nongenetic code-based RNA array (Figure 10_vi) was used for the sulfate-treated peanut’s Northern blots (Figure 5).

PS-treated peanut: Each GDH charge isomers in Figure 10g were made to convert the magnetoelectric change that occurred in the PS-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10_vii. Figure 10g showed that the PS-treated peanut hexameric GDH isoenzymes deviated from the binomial statistical pattern (Figure 11). Also, all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10_vii) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence.  Nongenetic code-based RNA array (Figure 10_iii) was used for the PS-treated peanut’s Northern blots (Figure 8).

Ammonium Chloride-treated peanut: Each GDH charge isomers in Figure 10h were made to convert the magnetoelectric change that occurred in the NH₄Cl-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10_viii. Figure 10h showed that the NH₄Cl-treated peanut hexameric GDH isoenzymes resembled that of the binomial statistical pattern (Figure 11). Also, all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10_viii) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence.  Nongenetic code-based RNA array (Figure 10_viii) was used for the NH₄Cl-treated peanut’s Northern blots (Figure 7).

PN-treated peanut: Each GDH charge isomers in Figure 10i were made to convert the magnetoelectric change that occurred in the PN-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10_ix. Figure 10i showed that the PN-treated peanut hexameric GDH isoenzymes resembled that of the binomial statistical pattern (Figure 11). Also, all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10_ix) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence.  Nongenetic code-based RNA array (Figure 10_ix) was used for the PN-treated peanut’s Northern blots (Figure 4).

PK-treated peanut: Each GDH charge isomers in Figure 10j were made to convert the magnetoelectric change that occurred in the PK-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10_x. Figure 10j showed that the PK-treated peanut hexameric GDH isoenzymes deviated from the binomial statistical pattern (Figure 11). Also, all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10_x) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence.  Nongenetic code-based RNA array (Figure 10_x) was used for the PK-treated peanut’s Northern blots (Figure 2).

4.3 GDH Charged Isomers and the Chimerenomic RNA Arays they Chigrammed:

Each GDH charged isomer is represented by subunits arranged vertically in the micrograph shown in Figure 10 (a–j), which corresponds to the vertical layout of chimerenomic nongenetic code-based RNA arrays chigrammed in Figure 10 (i–x). Each of these vertical chimerenomic RNA arrays signifies a comprehensive chimerenomic RNA family, termed chimerenomic ATinti RNA. When chimerenomic RNA is chigrammed using one or more vertical lanes of GDH charged isomers (as indicated in Figure 10, lanes 1–13), it produces a larger composite family of RNA known as chimerenomic NTinti RNA. This process underscores the intricate relationships between the charged isomers and the formation of complex chimerenomic RNA structures.

Figure 11: Binomial statistical distribution of GDH subunit polypeptides based on the a and α subunits being more acidic than the b subunit. The vertical columns are the subunit compositions of the GDH charge isomers used for the chigramming experiments of the electrochemical gradients of chimerenomic RNAs (Figures 1-9).

Rotofor IEF chamber pH values

<6.0                6.8                   7.5                   7.7                   8.2                   8.5                   8.8

αααααα         αααααB         ααααBB        αααBBB        ααBBBB       αBBBBB BBBBBB

AAAAAA      AAAAAB      AAAABB      AAABBB      AABBBB      ABBBBB

αααααA         ααααAB        αAAABB       αAABBB       αABBBB

ααααAA        αααAAB        ααAABB       ααABBB

αααAAA        ααAAAB       αααABB       

ααAAAA       αAAAAB      

αAAAAA

5.0    General Discussion     

5.1       Core Principles of Chimerenomic Chemistry as Demonstrated in these Experimental Studies

5.1.1   GDH Charged Isomers and Nongenetic RNA Synthesis

The experiments elucidate the role of GDH (Glutamate Dehydrogenase) charged isomers in the chigramming of their corresponding nongenetic code-based RNAs. This biochemical process is depicted in Figure 10, where micrographs are juxtaposed for enhanced clarity. The isoenzyme profiles generated from GDH fingerprints exhibit a consistent correlation with nongenetic code-based RNA arrays across a series of 80 chimerenomic research projects. This consistency underpins the foundation of chimerenomic chemistry in preclinical investigations, as delineated in the work by Osuji et al. [6].

5.1.2   Environmental Response Mechanisms

The NADH-GDH hexameric enzyme demonstrates the capacity to detect environmental alterations—such as fluctuations in nucleophiles, including opioid nucleophiles. In response to these shifts, it catalyzes the formation of novel charged isomers, which are subsequently chigrammed into new nongenetic code-based RNAs that act as environmental signatures (refer to Figure 10). These nongenetic code-based RNAs function to reprogram cellular metabolism, facilitating cell adaptation and survival in diverse environmental contexts. Specifically, they target various forms of genetic code-based RNAs—such as mRNA, siRNA, rRNA, etc.—allowing for precise modulation of metabolic pathways.

5.1.3   Experimental Evidence from Northern Blot Analyses

Figures 1 through 9 illustrate the results of Northern blot analyses, confirming that nongenetic code-based RNAs, chigrammed by GDH and homologous to specific mRNAs related to peanut development, selectively bind to ³²P-labeled nongenetic code-based RNAs. The findings indicate that these nongenetic RNAs are capable of selectively degrading superfluous or aberrant mRNAs while preserving essential mRNAs, thereby optimizing metabolic efficiency. The initial phase of this selective degradation involves the elimination of mRNAs from previous environment, thereby facilitating the de novo transcription of new genetic code-based RNAs crucial for gene expression.

5.1.4   Comparative Analysis of Environmental Effects

An analysis of Northern blot radiographs reveals distinct differences between Figure 9—representing a typical growth environment devoid of supplemental mineral nutrients—and Figures 1–8, which incorporated specified mineral enhancements. The radiograph from Figure 9, serving as a control, exhibited minimal mRNA expression for specific enzymes, except for Nitrate Reductase, which was selectively expressed due to the influence of nitrogen-fixing bacteria present in the compost soil. This observation indicates that nongenetic code-based RNAs initiate a degradative response towards legacy (past environment) mRNAs, reprogramming metabolism in response to new environmental conditions.

5.1.5   Interactions Among Nongenetic Code-Based RNAs

Significantly, the experiments demonstrated that nongenetic code-based RNAs do not exhibit degrading activity towards homologous nongenetic RNAs. They may, however, engage in binding interactions, as evidenced by the hybridization of ³²P-labeled GDH chigrammed nongenetic code-based RNAs to their homologous counterparts in the Northern blot analyses. This finding substantiates the hypothesis that nongenetic RNAs are non-immunogenic and exhibit low toxicity when introduced within the same species, marking a critical insight into their potential therapeutic applications.

The comprehensive series of projects—encompassing mineral nutrient treatments in peanuts, investigations involving NADH-GDH charged isomers, and the chigramming of corresponding nongenetic code-based RNAs—has culminated in extensive experimental studies. This includes ³²P-labeled nongenetic code-based RNA studies, hybridization experiments, and quantitative analyses via UN-SCAN-IT radiographic techniques. These methodologies have been replicated across 80 distinct projects, resulting in a cumulative total of over 400 projects.

The vast experimental dataset generated from these projects provides a robust foundation for chimerenomic RNA sciences, consistently yielding reproducible and reliable results. This extensive body of work solidified the principles underlying chimerenomic RNA technologies and lays the groundwork for our understanding and applications of this novel science.

5.1.6   GDH Charged Isomers and the Chimerenomic RNA Arays they Chigrammed:

Each GDH charged isomer is represented by subunits arranged vertically in the micrograph shown in Figure 10 (a–j), which corresponds to the vertical layout of chimerenomic nongenetic code-based RNA arrays chigrammed in Figure 10 (i–x). Each of these vertical chimerenomic RNA arrays signifies a comprehensive chimerenomic RNA family, termed chimerenomic ATinti RNA. When chimerenomic RNA is chigrammed using one or more vertical lanes of GDH charged isomers (as indicated in Figure 10, lanes 1–13), it produces a larger composite family of RNA known as chimerenomic NTinti RNA. This process underscores the intricate relationships between the charged isomers and the formation of complex chimerenomic RNA structures.

5.1.7   Metabolic Modulation via GDH Charged Isomers

Each GDH charged isomer, specific to a given environmental condition (as illustrated in Figure 10), facilitates targeted chigramming of nongenetic code-based RNA arrays. This targeted mechanism affirms the capacity for metabolic modulation across multiple genes. Notably, research conducted by AAPCR illustrates the modulation of metabolic pathways through innovative astrocyte studies. For instance, exposure to nucleophiles such as morphine initiates significant environmental changes, resulting in the production of engineered GDH isomers. These isomers have been optimized to facilitate the generation of complex NTinti RNAs, with millions of chimeres (Table 1) that may be homologous to thousands of mRNAs associated with various disease pathologies. Furthermore, NTinti RNAs specific to morphine and genes related to opioid overdose, neurotransmitters, and receptors are chigrammed, laying the groundwork for subsequent drug formulation efforts.

This comprehensive overview underscores the intricate principles of chimerenomic chemistry as elucidated in the experimental findings, highlighting their promising implications for therapeutic innovations in the biomedical field.

5.2       Medical and Clinical Applications of Chimerenomic Nongenetic Code-based RNA Technologies

5.2.1 The importance of chimerenomics in medicine is extensive including, but not limited to the following disciplines: neurology and neuroscience,  primary care, infectious diseases, microbiology, immunology and preventive medicine, rheumatology, neuropathology, pharmacy and pharmacology, emergency health, occupational health, environmental and global health, epidemiology and public health sciences, oncology, pediatrics, cardiology, biomedical engineering, biochemistry, molecular biology and genetics, physics and computational sciences, hepatology, gastroenterology, food science and human nutrition, nephrology, emergency medicine, maternal fetal medicine, dermatology, electrical and computer engineering, psychiatry and biobehavioral sciences,  chemistry, biomolecular and chemical engineering, reproductive biology, gynecology and obstetrics.

5.2.2   Introduction to Chimerenomic RNA and Metabolic Reprogramming

Emerging insights into how internal and external environmental signals influence cellular metabolism herald a transformative era in biotechnology, medical research, and clinical applications. The capacity of cells to convert environmental stimuli into nongenetic code-based RNA—and subsequently utilize that RNA to reprogram metabolic processes—is a groundbreaking finding with profound implications for medicine. These nongenetic code-based RNAs possess the potential to target specific metabolic pathways, effectively reprogramming and correcting metabolic dysregulation. This advancement sets the stage for novel therapeutic strategies and drug development in the coming century.

5.2.3   Targeted Therapeutic Potential of Nongenetic Code-Based RNAs

Each nongenetic code-based RNA functions as a candidate drug, uniquely equipped to target individual metabolic pathways or specific mRNAs (genes), or to modulate multiple genes concurrently. As a result, these nongenetic RNAs hold promise for treating diseases that have previously defied conventional therapeutic approaches. Failures of existing treatment methodologies often stem from an oversimplified understanding of disease etiologies, particularly the reductionist notion of "one gene, one disease."

This paradigm is increasingly recognized as inadequate; many diseases arise from multifactorial interactions among genes. The complexities of conditions such as opioid addiction illustrate this point—no single gene can account for the spectrum of addiction disorders, presenting a significant challenge to proponents of the "one gene, one disease" hypothesis. Therefore, the concepts of "many genes, one disease" or "one gene, many diseases" better capture the intricacies of human pathology, reinforcing the need for a holistic understanding of disease mechanisms.

5.2.4   Chimerenomic Science: Nature’s Evolutionary Insights

Chimerenomic science embraces the evolutionary wisdom embedded within biological systems, revealing how life has adapted to survive and thrive in diverse and often harsh environments. These adaptations include inherent mechanisms for repair and healing, which are integral to the concept of environmental signaling. The role of chimerenomic RNAs in mediating metabolic reprogramming in response to internal and external cues is well exemplified through the series of experiments detailed in this publication (see Figure 10).

5.2.5   Future Directions in Therapeutic Development

The implications of chimerenomic nongenetic code-based RNA technologies are vast. Future research should aim to elucidate specific pathways and mechanisms through which these RNAs exert therapeutic effects, as well as their potential interactions with existing treatment modalities. Additionally, rigorous clinical trials are essential to evaluate the efficacy and safety of these innovative therapies in diverse patient populations.

In summary, the intersection of chimerenomic science and medicine stands poised to reshape our understanding of disease, paving the way for targeted, personalized treatment strategies that address the complexities of human health and pathology. The promise of nongenetic code-based RNA technologies represents not just a leap in therapeutic capabilities but a redefinition of how we approach the treatment of diseases in the next century.

5.3       Characteristics of an Ideal Gene Targeting Technology: Chimerenomic RNA Technology Blueprint

Targeted Gene Regulation Using Chimerenomic RNA

Chimerenomic RNA technology exemplifies an ideal gene targeting mechanism, particularly demonstrated through its precision in targeting mRNAs for proteins enzymes such as phosphate translocator, phosphoglucomutase, glucosyltransferase, granule-bound starch synthase, GARS/GART, nitrate reductase, acetyl-CoA carboxylase, and NADH-GOGAT. The use of ³²P-labeled cDNA derived from nongenetic code-based RNA chigrammed from GDH charged isomers allowed for precise targeting and subsequent documentation via radiographic imaging (Figures 1–9). These radiographs illustrate the specific binding of cDNA to corresponding mRNAs, confirming the ability of chimerenomic RNAs to induce gene degradation and silencing with extreme specificity.

5.3.1   Specificity and Efficacy of Chimerenomic RNA

The experimental results substantiate that chimerenomic RNA possesses unique chemical properties enabling selective binding, degradation, and silencing of superfluous mRNAs—those arising from distorted gene expressions—while preserving normal mRNAs. Control experiments (Figure 9) clearly demonstrate the complete silencing of targeted mRNAs, reinforcing the specificity and efficacy of chimerenomic RNA as a tool for gene regulation.

Chimerenomic RNAs employ several mechanisms to identify superfluous RNAs, including the sensing of specific RNA segments, stoichiometric ratios, and environmental-dependent temporal expressions. These insights into the underlying molecular interactions offer a comprehensive understanding of how chimerenomic RNAs achieve selective targeting at a molecular level.

5.3.2   Advantages Over Genetic Editing Technologies

Chimerenomic RNA stands out as an ideal gene silencing vehicle due to its non-invasive nature; it can silence or degrade specific genes without the accompanying risks associated with genetic and genomic editing technologies. Unlike traditional gene editing techniques that alter DNA sequences, chimerenomic RNA operates independently of the cell's genomic integrity, mitigating potential adverse effects (see Table 3). This attribute positions chimerenomic RNA as a safer alternative, effectively silencing multiple genes concurrently, particularly when large innovative NTinti RNAs are employed, which can target hundreds of genes for regulatory purposes.

5.3.3   The Mechanism of Gene Regulation

The inherent capability of chimerenomic RNA to selectively degrade and silence aberrant mRNAs while sparing normal genetic transcripts underscores its extraordinary potential in gene regulation. This selective targeting facilitates the preservation of genetic integrity, allowing for the regulation of gene expression without modifying the underlying DNA sequences. This approach embodies a novel blueprint for gene regulation and preservation, emphasizing the ability to manage gene expression in a controlled and safe manner.

Therefore, chimerenomic RNA technology represents a paradigm shift in gene targeting methodologies. Its specificity, capacity for temporary or permanent gene silencing, and avoidance of detrimental impacts on DNA make it an exemplary candidate for advancing gene regulatory sciences and therapeutics. As research progresses, the full potential of chimerenomic RNA technologies is likely to revolutionize the fields of genetics, molecular biology, and medicine, providing innovative solutions for previously inexplicable diseases.

5.4       From Probes to Drugs: Nongenetic Code-based RNA Therapeutics

Overview of Nongenetic Code-based RNA Probes Used in these Studies

Our research has demonstrated the efficacy of nongenetic code-based RNA as probes in vitro, effectively interrogating metabolic processes that occur in vivo, as illustrated in Figures 1 through 9. These probes serve not only as diagnostic tools but also possess therapeutic potential when produced and deployed in vivo.

5.4.1   Transforming Probes into Therapeutics

Nongenetic code-based RNA can be chigrammed analogously to the probes used in experimental settings, allowing their application in clinical contexts to monitor and modulate metabolic processes associated with various disease states. These nongenetic code-based RNA drugs are designed to target specific mRNAs implicated in human diseases, thereby enabling interventions that facilitate gene silencing and metabolic reprogramming.

5.4.2   Mechanism of Action

The primary mechanisms through which nongenetic code-based RNA drugs exert their therapeutic effects include:

1. Gene Silencing: By targeting and degrading specific mRNAs associated with malignant or dysfunctional cellular pathways, these RNA drugs can effectively silence harmful gene expressions.

2. Metabolic Reprogramming: Nongenetic code-based RNA drugs can redirect cellular metabolism towards de novo pathways, restoring normal metabolic function and counteracting disease processes.

5.4.3   Clinical Implications

The application of nongenetic code-based RNA drugs holds tremendous promise for treating a wide range of human diseases. By precisely targeting and modulating specific genetic expressions, these therapeutics will provide novel treatment options for conditions that have thus far proven refractory to traditional therapies not only in aging, neurodegenerative and inflammatory disorders but also in a wider spectrum of medicine that include hepatology, hematology, nephrology, cardiology, oncology, immunology, pulmonology, neurology, mental health, infectious disease and dermatology.

Therefore, the transition from nongenetic code-based RNA probes to therapeutics exemplifies a significant advancement in molecular medicine. These RNA drugs not only allow for the interrogation of metabolic pathways but also offer a viable strategy for achieving therapeutic outcomes through gene silencing and metabolic reprogramming. Continued research and clinical trials are necessary to fully elucidate their potential benefits and expand their applications in the treatment of human diseases.

5.5       Targeting Multiple Specific Genes with Chimerenomic NTinti RNA: Novel Therapeutics for Drug Addiction

5.5.1   Overview of NTinti RNA in Addiction Research

In a recent investigation involving human astrocyte cells, we exposed those cells to varying molar concentrations of morphine to simulate environmental changes associated with addiction. As a result, large NTinti RNAs were generated and employed to target 17 specific mRNAs associated with addiction mechanisms [2, 17, 18, 19, 20, 21]. Notably, all targeted mRNAs exhibited homology to the NTinti RNA produced from astrocytes in the presence of morphine.

5.5.2   Properties of NTinti RNA Ideal for Drug Formulation

NTinti RNAs, while large molecules, display a liquid hydrophilic nature that permits solubility in just 1 µL of solution. This characteristic facilitates their formulation into deliverable drug forms, enhancing their practical applicability in clinical settings [3].

5.5.2.1            Mechanism of Action

The NTinti RNA drug demonstrates the following therapeutic actions:

1. Targeting Multiple mRNAs: The drug specifically targets multiple genes implicated in addiction, allowing it to effectively reprogram cellular metabolism.

2. Attenuating "Addiction Protein" Production: By silencing mRNAs within the addiction pathways, NTinti RNA reduces the synthesis of proteins associated with addictive behaviors.
3. Restoring Cellular Function: Through the degradation of superfluous mRNAs implicated in the addiction pathway, NTinti RNA aims to restore astrocyte cells to their normal functional state while sparing normal mRNAs.

5.5.3   Experimental Evidence

The experiments detailed in this publication (Figures 1–9) illustrate the shared mechanisms by which NTinti RNA targets, degrades, and silences abnormal mRNAs associated with addiction while preserving the integrity of normal mRNAs. This selectivity is crucial for maintaining healthy cellular function amidst therapeutic intervention.

5.5.4   Safety Profile

NTinti RNAs are designed to be tissue-specific and non-immunogenic, minimizing the risk of adverse reactions. Furthermore, they are anticipated to be free of metabolic side effects, making them a promising therapeutic option in the management of drug addiction.

5.5.5   Summary of Mechanisms

In the chimerenomic framework documented by Godson Osuji [1, 13], flanking nonhomologous sequences play an essential operational role in guiding template-independent RNA enzymes (NTintis) to clear malfunctioning transcripts. 

While traditional genetic code-based models (like siRNA or miRNA) rely on strict Watson-Crick base-pairing across the entire molecule to locate a target, chimerenomic pharmacology divides the therapeutic RNA enzyme into distinct functional zones, assigning the navigation burden to the nonhomologous ends. 

A. The Dynamic "Antenna" Mechanism

Natively chigrammed chimerenomic RNAs possess protruding 3′- and/or 5′-nonhomologous sequences that extend approximately 100 nucleotides past the core homologous alignment region. 

Spatial Scanning: Because these flanking sequences do not mirror the target genetic code, they do not wrap tightly into standard duplexes. Instead, they remain structurally flexible, acting as a molecular "antenna" or probe. 

Intracellular Navigation: The unique physical and electronic layout of these nonhomologous flanks allows the macromolecule to scan the dense intracellular matrix and actively guide the core segment directly to its matching total RNA substrate (such as mutated mRNA, rRNA, or tRNA). 

B. Preventing Premature Off-Target Binding

If a therapeutic molecule consisted only of the highly active, homologous sequence fragment (the chimere), it would randomly snap onto any partially complementary strand it encountered in the cell. 

Steric Protection: The flanking nonhomologous sequences physically wrap and shelter the internal homologous segment while in transit.

Target Isolation: This ensures that the active core is only exposed and deployed when the flanking sequences successfully orient and anchor the enzyme to the exact, correct target site.

Factors such as G+C content, genetic-induced steric hindrance, varying electromagnetic charges, and differing electrostatic and magnetoelectric energies aid chimerenomic RNAs in precisely targeting non-chimerenomic RNAs [3]. 

C. Setting the Stage for Electromagnetic Degradation

Once the nonhomologous sequences achieve the correct alignment, they lock the chimerenomic enzyme and the target substrate into a rigid total RNA-chimerenomic RNA enzyme complex. 

The Structural Trap: Capturing these complex live reveals that the flanking sequences physically hold the target strand in place.

Catalyzing Hydrolysis: By constraining the structural geometry, the flanks force the target genetic code-based strand into an energetically unfavorable state. Because the genetic transcript is the least electrostatically stable of the two different electromagnetic kinds of RNA, this physical alignment triggers its rapid electromagnetic degradation and clearance. 

Verification in the Laboratory

To prove this specific spatial role, the study described on sections 2.7 and 4.2 in this paper demonstrated that if these nonhomologous flanking sequences are experimentally clipped or omitted, the remaining naked homologous oligonucleotides fail entirely. Without the guiding and stabilizing force of the flanks, the homologous fragments cannot recognize or bind to target total RNAs, resulting in a complete loss of degradation activity.

Therefore, chimerenomic NTinti RNA represents an innovative approach to treating drug addiction by targeting multiple specific genes involved in the addiction pathway [2, 3, 17, 18, 19, 20, 21]. The ability to reprogram cellular metabolism and restore normal astrocyte function underscores the potential of NTinti RNA as a novel therapeutic strategy for many human diseases. Continued research and clinical trials will be essential to expand on these findings and explore the full therapeutic capabilities of NTinti RNA in the treatment of addiction and many human diseases.

Table 2a: Nucleotide Sequences of the GDH-synthesized Northern Probes

Granule-bound Starch Synthase (GBSS) gb|ACL98483.1|: starch synthase IIa

CAAUGCUAAGCGGGAAUACUCAGGACUGGCUCUUGGCGCGCAACUACCCUACUCAGGCCUGGCGGUUGCCGUACUAUUGCUACUCAGACCUGCCUCGAAUGAGAAAUAUUACUACUCAGGACUGGCUGUUGCCCAAACUAUCGAAACUAAGGACUGGCUGACGCCGUAACUAUCGCUACUCAGACACCUACCCUAUACGUCUGAUGGUCUUGGACUAACCGCUGA

NADH-GOGAT gb|L01660.1

GGGUAUAANCNNNUUGCAGGCGCGCUUAGGGGAAUGACCUGAGCUCUGACCAUGGGCUACGUCUCCGCCCUUUUGUACUUUACUCGAGUUCGUCCGGCACUUCCAACGGCUCGAAAACUUCACGUUGGGCUACCUCCUUUAGACGCCCCACUACAAAGUGGUCCUGCAUUACCUCGCCCUAAAGACCUGCCUGUAAAAGGUCGUCUGUCAGUGGCUUUUGCUGGCGGCGGUGAUGAAGUUCUUCCAAAUCCGUCCGAUAGCCAGUCCUGAGUAUU

Phosphate translocator2-1dbj|BAD16885.1

GUCCNANCGNCAAGCCGGCAAUUCCNACCAGNNANAAAUUCAAGGAACACNUUUCGGGACCCGAGNNNANNNACCCUUGANCGUCACCUAUGACCCGCUGAUCUCACACCAUCUCCCAUCGCCUUAAGGACCACAUCGUCACUUUACGCAUCUCUAGU

CCUCCUUGUAGGUACCGCUUCCGUCGAUGGACCUGGUUGUGACUGUGACUCCGUGCUUUCGCACCCCUCGUUUGUCCUAAUCUAUGGGACCAUCAGGUGCGGGAUUUGCUACGCUUGACCUACAACCCACGUUAAACCGUGCGUCAUAGCUUCGAUUGCGCAAUUCAAGCGGCGGACCCCUCAUGCCAGCGUUCUGACUUUGNGUUUCCUUAACUGCCCNUUN

Acetyl-CoA carboxylase (ACCase) gb|L39267.1|

UGACGUCGAUGCUAAGCGGGAAUACUCAGGACUGGCUCUUGCCGUAACUAUCGCUACUCAGGACUGGCUGUUGCCGUAACUAUCGCUACUCAGGACUGGCUGUUGCCGUAACUAUCGCCUACUCAGGACUGGCUGUUGCCGUAACUAUCGAUACUCAGGACUGGCUGUUGCCGUAACUAUCGCUACUCAGGACUGGCCCAUGCGUCAGAUGCUCUGGUCAUUC

Glucosyltransferase mRNA. GenBank accession: GQ373182.1

AGTTCCCCAGCAACGTATTTGCCAAAGCAAATGTCGCTAAAATAGACAACGCCACCAAAGCATCAGTTGAATCCCGAACAAAATAAACAAACATGAAAGGCTTGCAACACGCAACGCCACCTCCAAAAAGACGACAAGCGCAATCTTCTCGGTCGGACTCATAAGGG

Nitrate reductase 1. ACCESSION   NP_177899

AAANCCTTACTGGATCTCGTAAGACTGCGTACCCGATGCAAAAGGCGGGAAAACATGAAATAGCGTCAAGCAGGCCGTGAATTGCCGAGCTTTTGAAGTGCAACCCGATGGAGGTTATCTGCGGGTATGTTTCACCAGGAGTAtTGAGCGGGATTTCTGGACGGAACCAGCAGACAGTCACCGAAAACGACCCCGCCACTACTTCAAGAAGGTTTAGGCAGGCTATCGGTCAGGACTCATAAGGGCG

Formylglycinamide ribonucleotide amidotransferase (GARS/GART).  Accession number AY069939.1.

GNANNGGCGCGAATNGCCGCTTANGAGGTCCTGACCGAATNCNGCAGCAANGCACCCGTATGGCGGATGCTTCCTCACCGGTCACNCCTGNATCGGGGTANNCAGCTNCTACNAGGACNAGATACGCACATCCTACGAGACCAGTTACGCAGTCTACNANACNTNTATNAGTCCTGACCGAATCANANACGTGGGTGAANGACACCATTAACATGTCCGGNAAACCGTTNGGGNACCCANTCNACNAGACAGT

Phosphoglucomutase.  Accession number AJ250770.1

GNCGGCGCGNATNGCACCNGACGAGNNCGGTACACGAAATCANANAGCTNNAANNAGNAGCANATANNANACATNGANGGGNNCAAATNANGCNTCNCTANNANNGCTGTATGAAGNATNNCCACCNGTTACNTTNNGNNCGTCTGATCNAGNTNCGATGTAGNAGCNNTATGTATTNCCNAACTCAGTGTNGAGTATCCTTCNGTTAATGATGCGGTNAGTGAAGTACTTGGGAAGCNTCCCATCCGCGNTTANCAAANGNGGTGCTTTGGTTTCCCNGGTTTCGTACNTGAANGGTGACTTGTACGCTTGGACCGGATCCANANACANNTACAGGTGCGGGTTGTCCGCTACGATCAAGAAAGTCGGGTACGCAGTCTACGAGACCAAGGGCG

Table 2b. Some chemically synthesized oligonucleotide probes without the flanking antenna sequences.

Oligo probe for mRNA encoding inorganic phosphate translocator: CTCCCCACGCTTTCGTGCCTCAGTGTCAGTGTTGGTCCAGGTAGCTGCCTCGCCATGGATGTTCCTCCTGATCTCTACGCATTTCACTGCTACACCAGGAATTCCGCTACCCTCTACCAAC CACTCTAGTCGCCAGTAT

Oligo probe for mRNA encoding flavonoid biosynthesis gene:

CGGTCGGACTCATGTCGGTCAGGACTCATGTCGGTCAGGACTCATGTCGGTCAGGACTCA 

Oligo probe for mRNA encoding starch synthase IIa:

ACTCATCGCTATCAATGCCGCAGTCGGTCA 

Oligo probe for 16 S rRNA CGCGGTAATACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGTGGTCGTTTAAGTCCGTTGTGAAAGCCCTGGGCTCAACCTGGGAACTGCAGTGGATACTGGGCGACTAGAGTGTGGTAGAGGGTAGCGGAATTCCTGGTGTAGCAGTGAAATGCGTAGAGATCAGGAGGAACATCCATGGCGAAGGCAGCTACTGGACCAACACTGACACTGAGGCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCCTAAA

Table 3: Comparison of Genetic Gene Editing Technology with Chimerenomic Gene Silencing Technology.