NADH-glutamate dehydrogenase (GDH) hexameric isoenzymes chigram nongenetic code-based NTinti RNA enzyme when the environmental conditions of the cell/tissue/whole organism change. (Please refer to Table 1 for terminologies). The enzyme degrades total RNA in vitro and, in vivo without interfering with DNA; and therefore, has potential applications as therapeutic drug for the cure of health disorders caused by the dysfunction of the genetic code. We therefore conducted an expansive array of Northern blot research projects using peanut seed radio-labeled cDNAs of chimerenomic RNAs, to simultaneously probe peanut total RNAs and chimerenomic RNAs chigrammed by the cascade of electrochemical gradient GDH-charge isomers of the respective treatment of peanuts. The Northern probes were chimerenomic RNAs that were homologous to the mRNAs encoding crop yield enhancing enzymes: starch synthase, glucosyltransferase, phosphoglucomutase, acetyl CoA carboxylase, glutamate synthetase, nitrate reductase etc. The Northern blots showed that the number total of nucleotide sequence matches between the normal genetic code-based RNA and the chimerenomic RNAs chigrammed by the electrochemical gradient of GDH charge isomers was in the thousands, but that number of nucleotide sequence matches between the superfluous genetic code-based RNA and chimerenomic RNAs chigrammed by the electrochemical gradient of GDH charged isomers was less than a hundred. The bold chimerenomic Northern Bands showed that genetic code-based RNAs (mRNAs, rRNAs, precursor RNAs, tRNAs etc) are composite, complex molecules in their origin. The wide disparity in the number totals was how nongenetic code-based NTinti RNA enzyme distinguished superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter. The therapeutic importance of these characteristics of NTinti chimerenomic RNA is reviewed.
Keywords: chimerenomic Northern blot; gene targeting; new de novo transcription; NTinti RNA nonimmunogenic, ATinti nongenetic code-based RNA, Nongenetic code-based biology.
† ‡ American Academy of Primary Care Research, San Antonio, Texas USA.
Table 1: Chimerenomic Terminologies: glossary for the new life sciences.
1.These new terminology in life sciences describe the discovery of template-independent RNA processes that control the survival of cells and organisms other than genes. The building blocks of this life regulatory system are made up of a unique type of RNA that are not coded nor synthesized through the genetic code. These template-independent RNAs are called chimerenomic RNAs.
2.Chimerenomics: Is the study of everything (NTintis, chigramming, GDH-
chimmerization, chimere etc) about chimerenomic RNAs. Chimerenomics confers molecular chemistry pluripotency and totipotency on all cells and tissues. Chimerenomics are the processes by which whole organisms, cells and tissues differentiate, develop and grow by chigramming chimerenomic RNAs that interact with the changing physicochemical internal and external environmental conditions thereby reprogramming and optimizing those metabolic reactions that assure the continued survival of the organism.
3.Chimere: Is the minimum length of nucleotide sequence that can degrade homologous mRNA and other genetic code-based RNAs. Chimere is the active segment of NTinti.
4.NTinti: This is the chimerenomic RNA molecule chigrammed (synthesized) by NADH-
glutamate dehydrogenase hexameric redox cycle isoenzymes (GDH) in response to a specific environmental change. NTinti is also synthesized naturally in vivo during normal tissue differentiation, growth and development. Therefore, NTinti can be cell or tissue specific. One NTinti has more than one chimere.
5.Chigramming: This is the process of synthesis/construction/configuring of chimeres and NTintis by GDH. They are spontaneous processes. It is the conversion of the magnetoelectric changes in the environmental conditions of cells, tissues, whole organisms to the nucleotide sequences of chimerenomic RNAs.
6.GDH-Chimmerization: is the formation of chemical Schiff base of GDH isoenzymes
in response to a new environment leading to new hexameric isoenzyme complexes. This is the initiation process for chigramming.
7.Functional chimerenomics: is the study of the biological functions of chimere and NTinti.
8.Differential chimerenomics: is the comparison study of the chimeres and NTintis
from same or different tissues under various environmental conditions.
9. ATinti RNA: These are large chimerenomic RNAs chigrammed from one single lane of GDH charged isomer, they are smaller than NTinti that are produced from multiple lanes of GDH charged isomers.
10. Other life science terminologies
a). Clinical Chimerenomics: The application of chimerenomics to clinical studies.
b). Chimerenomic Medicine: The application of chimerenomics to primary care in the prevention and treatment of human disorders, diseases and wellness conditions.
c). Chimerenomic Chemistry
d). Chimerenomic Physiology
e). Molecular Chimerenomics
f). Chimerenomic Biology
1.0 Introduction
When the magnetoelectric environmental conditions of an organism have changed, the conformation of hexameric NADH-glutamate dehydrogenase changes (GDH), and it produces template independent NTinti (nongenetic code-based chimerenomic) RNA enzyme that degrades abnormal genetic code-based RNAs [1, 2]. Many research programs have been undertaken successfully to harness the properties of the nongenetic code-based NTinti RNA enzyme towards the understanding of human disease prognosis and therapy [2, 3]. There are many differences between chimerenomic nongenetic code-based RNA and genetic code-based RNA. Chimerenomic RNA is a liquid and has flexible structure, chigrammed by GDH, induced by environmental exposure, more thermally stable, is RNA enzyme, degrades genetic code-based RNA in vitro and in vivo, not translatable, clinical use does not cause abnormal protein production, has high potential energy [3]. Conversely, genetic code-based RNA is a solid, has steric hindrance, transcribed from DNA, is driven by genetics, thermally unstable, has no enzyme activity, is translatable, easily cleaved, clinical use causes abnormal protein production, has low potential energy, does not degrade total RNA in vitro. By targeting the aberrant genetic code-based RNA sequences, NTinti RNAs enhance the precision of therapeutic interventions, making them available in modern medicine [2,3]. Hereunder we present research evidence that shows how chimerenomic RNA enzyme degrades superfluous and abnormal genetic code-based RNA but not normal genetic code-based RNA.
2.0 Materials and Methods
2.1 Plant Material: Treatment of Peanuts with Mineral Salt Solutions.
Peanut (Arachis hypogaea L. Cv. Virginia) seeds were planted in boxes 242 × 244 × 31 cm (width × length × depth) [4], each filled with Metro-Mix 700 peat moss. About 100 - 110 seeds were planted per box. The applied mineral salt compositions targeted the binomial subunit polypeptide compositions of the GDH isoenzymes [5]. The first box was left as the untreated control; the second box (N) was treated with 1 L of NH4Cl solution (25 mM), the third box (Pi) was treated with 1 L of Na2HPO4 solution (20 mM); the fourth box (S) was treated with 1 L of Na2SO4 solution (50 mM); the fifth box (N + P + K + S) was treated with 1 L of combined NH4Cl (25 mM), Na2HPO4 (20 mM), Na2SO4 (50 mM), and KCl (4 mM) solution; the sixth box (P + K) was treated with 1 L of combined Na2HPO4 (20 mM) and KCl (4 mM) solution; the seventh box (N + S) was treated with 1L of combined NH4Cl (25 mM) and Na2SO4 (50 mM) solution; the eighth box (P + N) was treated with 1 L of combined Na2HPO4 (20 mM) and NH4Cl (25 mM) solution; the nineth box (P + S) was treated with 1 L of combined Na2HPO4 (20 mM) and Na2SO4 (50 mM) solution as described before [4]. The boxes were watered every other day. Mineral salt solutions were applied sequentially, first at pre-flowering stage (2 weeks after seed germination), second at flowering, and thirdly at post-flowering. When the leaves turned yellow (peanut maturity), seeds were harvested, allowed to dry on the greenhouse floor for about 2 weeks, and weighed; and stored at –30˚C.
2.2 Purification of GDH Isoenzymes: GDH was extracted from the peanut seeds (30 g) by homogenization at 4 0C with 100 mL of buffer [4, 5, 6, 7] containing 5 units per mL of each of RNase A and DNase 1, and subjected to fractional (NH4)2SO4 precipitation, preparative-scale isoelectric focusing (IEF; Rotofor, Bio-Rad, Hercules, USA) followed by dialysis of the fractions as described before [8]. Rotofor fractions (0.2 mL) were purified by native 7.5 % polyacrylamide gel electrophoresis (PAGE) (100 V, 20 h, 4 0C) to remove other proteins, and nucleic acid contaminations. Bio-Rad protean II cell was used for the duplicate gel electrophoresis. After the electrophoresis, one gel was stained with phenazine methosulphate/tetrazolium blue reagent to reveal the GDH hexameric isoenzyme distribution pattern [6, 7, 8]; the result was photo-documented. GDH isoenzymes were eluted (30 min, 100 V) from the second electrophoresed gel with 0.05 M solution of Tris base at subzero temperature using whole gel eluter (Bio-Rad) as described before [6, 7, 8]. The whole gel fractions were not combined but each fraction was applied to chigram chimerenomic (nongenetic code-based) RNA.
2.3 Chimerenomic RNA Production: RNAs were chigrammed with the whole-gel fractions of GDH charge isomers purified from the control or mineral salt-treated peanut seeds. RNA chigramming was conducted in the combined amination and deamination substrate solutions containing 0.87 mM NH4Cl, 3.5 mM CaCl2,10.0 mM α-ketoglutarate (α-KG), 0.23 mM NADH, 0.6 mM each riboNTP, 0.37mM NAD+, 3.23 mM L-glutamate, 5 Units of RNase inhibitor, 5 Units of DNase 1, and 5.0µg actinomycin D. Chigramming was with 0.2 mL of GDH charge isomers containing about 4 µg protein per mL as described before [6]. The final volume of the reaction was brought to 0.4 mL and pH 8 with Tris-HCl solution. Reactions were incubated at 16 0C overnight and stopped by phenol-chloroform (pH 4.5) extraction of the enzyme. The RNA was precipitated with ethanol; then electrophoresed through 2% agarose gel, the results were photo-documented. RNA chigramming with GDH charge isomers per harvested treated peanut seeds were repeated several times, and after glyoxal-agarose gel electrophoresis, the RNA fractionation patterns were trans-blotted to nylon membrane ready for Northern hybridization screenings.
2.4 Restriction Fragment Differential Display PCR: In order to prepare the probes for analyzing the degradation of genetic code-based RNA by the nongenetic code-based RNA enzyme chigrammed by GDH, cDNAs of the nongenetic code-based RNAs were synthesized with 2µg of each product RNA chigrammed by the GDH charge isomers using random hexamer primer, and the restriction fragment differential display (RF-DD) PCR was conducted according to the methods of Display Systems Biotech, Vista, CA, USA. Selected cDNA fragments were subcloned into pCR4-TOPO vector and transformed into TOP10 One Shot Chemically Competent Escherichia coli (Invitrogen, Carlsbad, CA), followed by overnight growth on selective plates. Up to ten positive transformant colonies were picked per plate and cultured overnight in LB medium containing 50 µg/mL of ampicillin. Plasmid DNA was purified with a plasmid kit (Novagen, Madison, WI), and the insert cDNA fragment was sequenced with T3 and T7 primers by Genemed Synthesis, Inc (South San Francisco, CA, USA).
2.5 Functional and Structural Characterization of Chimerenonic RNAs: To assign putative functions to the RNAs chimmerized by GDH, cDNA sequences were used as queries to search the NCBI nucleotide-nucleotide (including ESTs) BLAST (blastn), and non-redundant protein translation (blastx) databases [9]. Putative functions were assigned to alignments with the highest scores. To study sequence homologies among the GDH-chigrammed RNAs, the NCBI BLASTN 2 Sequences alignment algorithm was used [10].
2.6 Northern Blot Analysis: Total RNA was extracted from the control and mineral salt-treated peanuts using the acidic phenol/chloroform method [11]. Equal amounts (10 µg) of total RNAs and chimerenomic RNAs chigrammed by the GDH charge isomers of the control and treated peanuts were loaded on 2% (w/v) glyoxal-agarose gels, electrophoresed, and then photographed to verify RNA quality and to ensure that samples were equally loaded. RNA was electro-transferred from the agarose gel (Trans-Blot SD cell of Bio-Rad, Hercules, CA) onto Brightstar-Plus nylon membranes (Ambion, Austin, TX, USA) and immobilized to the membrane by oven heating at 85 0C for 2h. Electro-transfer from the gel was repeated onto a second Brightstar-Plus nylon membrane and processed together with the first membrane to verify completeness of transfer of RNA from the gel.
For the preparation of DNA probes, cDNA inserts were amplified by PCR from the corresponding plasmids (10 ng) using T7 forward and T3 reverse primers (1 µM each), [α32P]dATP (3000 Ci/mmol, 10 mCi/mL, 2 µL), dCTP/dGTP/TTP mix (50 mM, 2 µL), Taq polymerase (1 U), in a final volume of 20 µL. Amplification was for 35 cycles (95 0C for 60 seconds, 55 0C for 30 seconds, and 72 0C for 60 seconds), followed by final extension incubation at 72 0C for 10 min. Unincorporated nucleotides were removed from the labeled cDNA inserts by chromatography through short column of Sephadex G50 [12, 13].
Membranes with immobilized RNAs were prehybridized with ULTRAhyb buffer (Ambion, Austin, TX, USA) at 68 0C for 30 min and hybridized with 32P-labeled cDNA inserts as probes overnight at 68 0C. The membranes were washed (15 min, 42 0C) followed by another wash (15 min, 68 0C) with NorthernMax low stringency wash solution (Ambion, Austin, TX, USA) to remove unbound probes. The blot was exposed to X-ray film with intensifying screens at -80 0C for autoradiography. The band intensities were digitalized using UN-SCAN-IT gel digitizing software (Silk Scientific, Inc., Orem, Utah, USA).
Northern analysis with each labeled cDNA of GDH-chigrammed RNA probe was carried out in duplicate with a second agarose gel loading of RNA preparations to verify reproducibility of results [12, 13].
3.0 Results and Discussion
3.1 Chimerenomic Northern Blot. Chimerenomic RNA enzyme degrades total RNA in vitro and in vivo [1, 13]. Therefore, the scientific logic of these research projects on the selective degradation of superfluous genetic code-based RNAs is that the labeled first cDNA strand of the nongenetic code-based (GDH-chimmerized) RNA hybridizes (base-pairing) to and links the chimerenomic (nongenetic code-based) RNA directly to its target homologous mRNA in total RNA (genetic code-based RNA), thus serving as a failproof method for confirming the presence or absence of the Northern bands of the specific mRNAs on the Northern blots. The presence of a target mRNA band on Northern blot confirms it is not an abnormal genetic code-based RNA; whereas the absence therefrom confirms it is a superfluous genetic code-based RNA having been degraded in vivo by chimerenomic RNA enzyme induced by the changes of the environmental conditions where the peanut was cultivated. Northern blot results (Figures 1 – 9) visually illuminate this chimerenomic science and explain how nongenetic code-based NTinti RNA enzyme distinguishes superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter.
The Northern probe nucleotide sequences (Table 2) selected for this study had been identified as optimizers of peanut seed nutritious and biomass yields [1, 4, 5, 13, 14].
3.2 The NPKS-treated Peanut
Northern bands of different densitometric intensities were obtained (Figure 1) for the mRNAs encoding phosphate translocator, granule-bound starch synthase, GARS/GART, phosphoglucomutase, and glucosyltransferase. Total RNA Northern band in the size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided tissue-specific environmental protection labels for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for inorganic phosphate translocator, granule-bound starch synthase, phosphoglucomutase, glucosyltransferase and GARS/GART were present in the stoichiometric ratios of 6:2:1:1:4 respectively. Based on the wide stoichiometric ratios of the surviving mRNAs, the mechanism by which nongenetic code-based NTinti RNA
Figure 1: The NPKS-treated Peanut. Environment/Tissue specific protection of the normal mRNAs encoding (a) phosphate translocator, (b) granule-bound starch synthase, (c) phosphoglucomutase, (d) glucosyltransferase, and (e) GARS/GART by nongenetic code-based RNA enzyme in NPKS-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel purified; and total RNA isolated from the same NPKS-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were transblotted onto nylon membranes followed by membrane screening with 32P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed. Only normal mRNAs identified in the electrochemical gradients of homologous chimerenomic RNA enzymes were allowed de novo transcriptional production.
enzyme distinguishes superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter is that when
a magnetoelectric change occurs in the environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing superfluous mRNAs of the previous environment, and then allows the de novo transcription of only normal mRNAs to take place. In that way, the new NTinti RNA enzyme degraded all the superfluous/abnormal mRNAs, and reduced the normal mRNA levels for phosphoglucomutase, glucosyltransferase and granule-bound starch synthase to the lowest minimum stoichiometric (reacting molar quantities) ratios.
The enforcement of the reacting quantities of genetic code-based RNAs to comply with molar (stoichiometric) ratios is scientifically important because chemical reactions occur in whole number ratios between the reactants not only in vitro but also in vivo. When genetic code-based RNAs are not present in their stoichiometric ratios, chimerenomic NTinti RNA enzyme recognizes them as superfluous, unnecessary, abnormal and wasteful expenditure of cellular energy; and spontaneously degrades them.
In the experimentations, the chimerenomic RNAs were chigrammed by the same GDH charge isomers of the same NPKS-treated peanut seeds; the total RNA was purified from the same peanut seeds; the only variable being the different chimerenomic RNA probes that were homologous to the respective mRNAs thus validating the comparative analyses applied to explain the Northern blot results.
In the series of chimerenomic research projects, this was one of the 80 projects, each project comprising of four experiments in duplicate repeats (total of 640 discrete experiments) that established the quadrilateral crisscrossing research protocols [1; 2] of the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme could offer the hope of total cure for human health disorders caused by dysfunctional genetic code (Figures 10, 11).
3.3 The PK-Treated Peanut
Northern bands of different densitometric intensities were obtained (Figure 2) for the mRNAs encoding granule-bound starch synthase, phosphoglucomutase, glucosyltransferase, GARS/GART, and nitrate reductase. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment-specific identification protection for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for starch synthase, phosphoglucomutase, glucosyltransferase, GARS/GART, and nitrate reductase were present in the stoichiometric ratios of 6:2:1:10:1 respectively. Based on the wide stoichiometric ratios of the surviving mRNAs (Figure 2), the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous/dysfunctional genetic code-based RNA from normal genetic code-based RNA, degrading the former and sparing the latter is that when a physicochemical change occurs in the environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing mRNAs of the previous environment, and then allows the de novo transcription of only the normal genetic code-based RNAs. In that way, the new NTinti RNA enzyme degraded all the superfluous, abnormal unnecessary mRNAs for phosphoglucomutase, glucosyltransferase, and nitrate reductase; and minimized their normal mRNAs to the lowest stoichiometric (reacting molar quantities) ratios (Figure 2).
Figure 2: The PK-treated Peanut. Environment/Tissue specific protection of the normal mRNAs encoding (a) granule-bound starch synthase, (b) phosphoglucomutase, (c) glucosyltransferase, (d) GARS/GART, and (e) nitrate reductase by nongenetic code-based RNA enzyme in PK-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel purified; and total RNA isolated from the same PK-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were transblotted onto nylon membranes followed by membrane screening with 32P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed. Only mRNAs protected by the electrochemical gradients of homologous chimerenomic RNA enzymes were allowed to be produced by de novo transcription.
In the experimentations (Figure 2), the chimerenomic RNAs were chigrammed by the same GDH charge isoenzymes of the same PK-treated peanut seeds; the total RNA was purified from the same PK-peanut seeds; the only variable being the chimerenomic RNA probes that were homologous to the respective mRNAs thus validating the comparative analyses applied to explain the Northern blot results.
In the series of chimerenomic research projects, this was one of the 80 projects that established the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme could offer hope of total cure for some human health ailments.
3.4 The Sodium Phosphate-treated Peanut
Northern bands of different densitometric intensities were obtained (Figure 3) for the mRNAs encoding phosphoglucomutase, glucosyltransferase, acetyl CoA carboxylase, GARS/GART, and NADH-GOGAT. Total RNA Northern band in the over-size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also, present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment-specific identification labels for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for phosphoglucomutase, glucosyltransferase, acetyl CoA carboxylase, GARS/GART, and NADH-GOGAT were present in the stoichiometric ratios of 10:3:2:4:6 respectively. Based on the wide stoichiometric ratios of the surviving mRNAs (Figure 3), the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous/abnormal genetic code-based RNA from normal genetic code-based RNA, degrading the former and sparing the latter is that when a magnetoelectric change occurs in the environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing dysfunctional mRNAs of the previous environment, and then allows the de novo transcription of only normal genetic code-based RNAs. In that way, the new NTinti RNA enzyme degraded all the mRNAs for glucosyltransferase, acetyl CoA carboxylase, and NADH-GOGAT; and limited their normal mRNA transcriptions to the lowest stoichiometric ratios of 1:1:1 respectively (Figure 3).
Figure 3: The Sodium Phosphate-treated peanut. Environment/Tissue specific protection of the normal mRNAs encoding (i) phosphoglucomutase, (ii) glucosyltransferase, (iii) acetyl CoA carboxylase, (iv) GARS/GART, and (v) NADH-GOGAT by nongenetic code-based RNA enzyme in inorganic phosphate-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel-purified; and total RNA isolated from the same phosphate-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with 32P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed.
In the experimentations (Figure 3), the chimerenomic RNAs were chigrammed by the same GDH charge isomers of the same phosphate-treated peanut seeds; the total RNA was purified from the same phosphate-treated peanut seeds; the only variables were the mRNA probes that were homologous to the different chimerenomic RNAs thus validating the comparative analyses applied to explain the Northern blot results.
In the series of chimerenomic research projects, this was one of the 80 projects that established the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme could offer hope of total cure for human health ailments caused by dysfunctional genetic code.
3.5 The PN-treated Peanut
Northern bands of similar densitometric intensities were obtained (Figure 4) for the mRNAs encoding phosphate translocator, and granule-bound starch synthase. Total RNA Northern band in the over-size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment-specific labels for each genetic code-based mRNA target. Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for inorganic phosphate translocator, and granule-bound starch synthase were present in the stoichiometric ratios of 1:1. The low and equal stoichiometric ratio of the two mRNAs confirmed the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous/abnormal genetic code-based RNA from normal RNA, degrading the former and sparing the latter is that when the PN physicochemical change occurred in the environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing mRNAs of the previous environment, and then allowed the de novo transcription of only normal mRNAs. In that way, the new NTinti RNA enzyme degraded all the superfluous/abnormal mRNAs for phosphate translocator, and granule-bound starch synthase and reduced their normal mRNA concentrations to the lowest minimum stoichiometric ratio of 1:1 (Figure 4).
Figure 4: The PN-treated peanut. Environment/Tissue specific protection of the normal mRNAs encoding (a) phosphate translocator, and (b) granule-bound starch synthase by nongenetic code-based RNA enzyme in PN-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel purified; and total RNA isolated from the same PN-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with 32P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed.
In the experimentations, the chimerenomic RNAs were chigrammed by the same GDH charge isomers of the same PN-treated peanut seeds; the total RNA was purified from the same PN-treated peanut seeds; the only variables were the probes for the mRNAs that were homologous to the different chimerenomic RNAs thus validating the comparative analyses applied to explain the Northern blot results.
3.6 The Sodium Sulfate-treated Peanut
Northern bands of different densitometric intensitiess were obtained (Figure 5) for the mRNAs encoding phosphate translocator, nitrate reductase, and GARS/GART. Total RNA Northern band in the over-size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment-specific identification labels for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for inorganic phosphate translocator, nitrate reductase, and GARS/GART were present in the stoichiometric ratios of 6:1:3 respectively. Based on the wide stoichiometric ratios of the surviving mRNAs, the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter is that when a magnetoelectric change occurs in the environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing superfluous mRNAs of the previous environment, and then allows the de novo transcription of only normal mRNAs to take place. In that way, the new NTinti RNA enzyme degraded all the superfluous/alternatively spliced mRNAs for nitrate reductase, and GARS/GART, and reduced their normal mRNA to the lowest minimum stochiometric ratio of 1:3 (Figure 5).
In the experimentations (Figure 5), the chimerenomic RNAs were chigrammed by the same GDH charge isomers of the same sulfate-treated peanut seeds; the total RNA was purified from the same sulfate – treated peanut seeds; the only variables were the chimerenomic RNA probes that were homologous to the different mRNAs thus validating the comparative analyses applied to explain the Northern blot results.
In the series of chimerenomic research projects, this was one of the 80 projects that established the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme as drug could offer the hope of total cure for some human health disorders.
Figure 5: The Sodium Sulfate-treated peanut. Environment/Tissue specific protection of the normal mRNAs encoding (a) phosphate translocator, (b) nitrate reductase, and (c) GARS/GART by nongenetic code-based RNA enzyme in sodium sulfate-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel-purified; and total RNA isolated from the same sulfate-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with 32P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed.
3.7 The NS-treated Peanut
Northern bands of different densitometric intensities were obtained (Figure 6) for the mRNAs encoding phosphoglucomutase, acetyl CoA carboxylase, and nitrate reductase. Total RNA Northern band in the 0ver-size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment-specific identification labels for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for inorganic phosphoglucomutase, acetyl CoA carboxylase and nitrate reductase were present in the stoichiometric ratios of 4:1:3 respectively. Based on the wide stoichiometric ratios of the surviving mRNAs, the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter is that when a magnetoelectric change occurs in the environment, and if there is excess NTinti RNA produced, the new NTinti RNA enzyme spontaneously degrades all the pre-existing unnecessary mRNAs of the previous environment, and then allows the de novo transcription of only normal mRNAs to take place. In that way, the new NTinti RNA enzyme degraded all the superfluous/abnormal mRNAs for acetyl CoA carboxylase and nitrate reductase and reduced their normal mRNA to the lowest minimum stochiometric ratio of 1:3 (Figure 6).
In the experimentations (Figure 6), the chimerenomic RNAs were chigrammed by the same GDH charge isomers of the same NS-treated peanut seeds; the total RNA was purified from the same NS–treated peanut seeds; the only variables were the chimerenomic RNA probes that were homologous to the different mRNAs thus validating the comparative analyses applied to explain the Northern blot results.
In the series of chimerenomic research projects, this NS – treated peanut was one of the 80 projects that established the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme as drug could offer the hope of total cure for human health disorders caused by dysfunctional genetic code.
Figure 6: The NS-treated peanut. Environment/Tissue specific protection of the normal mRNAs encoding (a) phosphoglucomutase, (b) acetyl CoA carboxylase, and (c) nitrate reductase by nongenetic code-based RNA enzyme in NS-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel-purified; and total RNA isolated from the same NS-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with 32P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed.
3.8 The Ammonium chloride – treated Peanut
Northern bands of different densitometric intensities were obtained (Figure 7) for the mRNAs encoding phosphate translocator, granule-bound starch synthase, phosphoglucomutase, and glucosyltransferase. Total RNA Northern band in the over-size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment/tissue-specific identification labels for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the mRNAs for phosphate translocator, granule-bound starch synthase, phosphoglucomutase, and glucosyltransferase were present in the stoichiometric ratios of 3:2:1:2 respectively. Based on the narrow stoichiometric ratios of the surviving mRNAs (Figure 7), the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous genetic code-based RNA from normal genetic code-based RNA, degrading the former and sparing the latter is that when a magnetoelectric change occurs in the environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing abnormal mRNAs of the previous environment, and then allows the de novo transcription of only normal genetic code-based RNAs to take place. In that way, the new NTinti RNA enzyme degraded all the superfluous mRNAs for granule bound starch synthase, phosphoglucomutase, and glucosyltransferase; and limited their normal mRNA transcriptions to the lowest stoichiometric ratios of 2:1:2 respectively (Figure 7).
In the experimentations (Figure 7), the chimerenomic RNAs were chigrammed by the same GDH charge isoenzymes of the same ammonium chloride – treated peanut seeds; the total RNA was purified from the same ammonium chloride–treated peanut seeds; the only variables were the mRNA targets that were homologous to the different chimerenomic RNA probes thus validating the comparative analyses applied to explain the Northern blot results.
In the series of the peanut chimerenomic research projects, this ammonium chloride - treated peanut was one of the 80 projects that established the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme could offer hope of total cure for some human health ailments.
Figure 7: The Ammonium Chloride-treated peanut. Tissue/environment-specific protection of normal mRNAs encoding (a) phosphate translocator, (b) granule-bound starch synthase, (c) phosphoglucomutase, and (d) glucosyltransferase by nongenetic code-based RNA enzyme in ammonium chloride-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel-purified; and total RNA isolated from the same ammonium chloride-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with 32P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed.
3.9 The PS – treated peanut
Northern bands of different densitometric intensities were obtained (Figure 8) for the mRNAs encoding phosphate translocator, and phosphoglucomutase. Total RNA Northern band in the size range of ten thousand nucleotides long were in the category of precursor genetic code-based RNAs. Also present were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment-tissue specific identification labels for every genetic code-based RNA Northern band. UN-SCAN-IT gel digitizing software semiquantitative analysis of the mRNA band intensities showed that the two mRNAs were present in the stoichiometric ratio of 1:1. Based on the equal stoichiometric ratio of the surviving mRNAs, the mechanism by which nongenetic code-based NTinti RNA enzyme distinguishes superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter is that when a magnetoelectric change occurs in the
Figure 8: The PS-treated peanut. Tissue/environment-specific protection of the normal mRNAs coding (a) phosphate translocator, and (b) phosphoglucomutase, by nongenetic code-based RNA enzyme in PS-treated peanut. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel-purified; and total RNA isolated from the same PS-treated peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with 32P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed. Only mRNAs protected by the electrochemical gradients of homologous chimerenomic RNA enzymes were allowed to be produced by de novo transcription. Any mRNAs/genetic code-based RNAs lacking the protective gradient of electrochemical homologous chimerenomic RNA enzymes were identified as superfluous/abnormal and degraded.
environment, the new NTinti RNA enzyme spontaneously degrades all the pre-existing dysfunctional mRNAs of the previous environment and then allows the transcription of only normal mRNAs to take place. In that way, the new NTinti RNA enzyme degraded all the superfluous mRNAs for phosphate translocator, phosphoglucomutase and reduced their normal mRNA to the lowest minimum stochiometric ratio of 1:1 (Figure 8).
In the experimentations (Figure 8), the chimerenomic RNAs were chigrammed by the same GDH charge isoenzymes of the same PS -treated peanut seeds; the total RNA was purified from the same PS – treated peanut seeds; the only variables were the cDNAs of chimerenomic RNA probes that were homologous to the different target mRNAs thus validating the comparative analyses applied to explain the Northern blot results.
In the series of chimerenomic research projects, this PS – treated peanut was one of the 80 projects that established the science of chimerenomic chemistry as a preclinical research discipline – how chimerenomic NTinti RNA enzyme as drug could offer the hope of total cure for some human health disorders.
3.10 The Control peanut
The control peanut’s mRNAs encoding phosphate translocator protein, phosphoglucomutase, and nitrate reductase did not give Northern bands (Figure 9). Also, absent were the cascades of homologous nongenetic code-based chimerenomic RNAs electrochemical gradient formations that accompanied and provided environment/tissue identification labels for every genetic code-based RNA Northern band so far observed in all of the other treated peanuts. This is to highlight the known chimerenomic concept that the control organism is a treated organism but the treatment’s contents and composition are unknown [14]. In this regard, it is just appropriate to recognize that the interactions of the control peanut with the soil physics (environment) to induce the unique physicochemical changes on the peanut GDH was dissimilar to the mineral salt-treated peanuts. Essentially, the GDH of the control peanut was not the control GDH [14].
Therefore, every genetic code-based RNA has a cascade of homologous nongenetic code-based RNAs that identifies it in the Northern blots (Figures 1-9). When the magnetoelectric change occurred in the environment of the Control peanut, the new chimerenomic RNA enzymes that were produced degraded all the pre-existing abnormal mRNAs of the previous environment but then did not allow the transcription of normal mRNAs encoding phosphate translocator, phosphoglucomutase, and nitrate reductase to resume. This is a major difference that suggests all the pre-existing mRNA for phosphate translocator, phosphoglucomutase, and nitrate reductase of the control peanut were abnormal and/or superfluous.
The other difference in the control peanut’s Northern blots (Figure 9) was that the homologous nongenetic code-based chimerenomic RNAs that identified the unique environment/tissue interactions were patchy discontinuous cascades unlike the continuous chimerenomic NTinti RNA electrochemical gradient formations witnessed in the Northern blots for the mineral salt-treated peanuts (Figures 1-8).
The differences explain how nongenetic code-based NTinti RNA enzyme distinguishes superfluous genetic code-based RNA from normal RNA, degrading the former and sparing the latter, as follows:
A.1. The continuous chimerenomic NTinti RNA electrochemical
gradient cascade formations were created by the more than thousands of nucleotide sequence matches between the normal genetic code-based RNAs (mRNA, rRNA, tRNA, precursor RNA etc) and the chimerenomic RNAs chigrammed by the GDH charge isomers.
A.2. The number total of the thousands of nucleotide sequence matches was the tissue/environment-specific signaling to spare the normal genetic code-based RNA from chimerenomic NTinti RNA enzyme’s magnetoelectric destruction. This is the chemical basis of the tissue specificity of NTinti chimerenomic RNA enzyme activity.
B.1 The discontinuous and patchy cascades of the homologous nongenetic code-based RNAs that identified the unique environment/tissue interactions in the control peanut were created by the less than a hundred nucleotide sequence matches between the superfluous genetic code-based RNAs (mRNA, rRNA, tRNA etc) and the chimerenomic RNAs chigrammed by the GDH charge isomers.
Figure 9: The Control Peanut. Tissue/environment-specific signaling that led to the degradation of superfluous mRNAs encoding (a) phosphate translocator, (b) phosphoglucomutase, and (c) nitrate reductase by nongenetic code-based RNA enzyme in the control peanut. Northern bands were not produced by the indicated mRNAs. Chimerenomic RNAs (lanes 1 - 12) chigrammed by the GDH charge isomers were whole-gel-purified; and total RNA isolated from the same control peanut were electrophoresed through 2% agarose gel. The electrophoresed gels were trans-blotted onto nylon membranes followed by membrane screening with 32P-labeled cDNAs of the GDH-chigrammed RNA probes that were homologous to the mRNAs encoding each of the indicated enzymes. The membranes were washed with high stringency solutions and autoradiographed. Only mRNAs protected by the electrochemical gradients of homologous chimerenomic RNA enzymes were allowed to be produced by de novo transcription. Accordingly, the abnormal/superfluous mRNAs encoding (a) phosphate translocator, (b) phosphoglucomutase, and (c) nitrate reductase were not protected by electrochemical gradients of homologous chimerenomic RNA enzymes.
B.2. The number total of the less than a hundred nucleotide sequence matches was the tissue/environment-specific signaling for the superfluous genetic code-based RNAs (mRNAs, rRNAs, tRNAs etc) to get degraded by chimerenomic NTinti (nongenetic code-based) RNA enzyme.
These graphical details about the NTinti’s control of gene expression have medical implications in how to cure human health disorders. Genetic and genomic medicine could not capture these cinematographic moments (Figures 1-9) in the regulation of DNA gene expression.
This is a novel, and indeed a phenomenal environment-guided physicochemical description of the regulation of DNA gene expression because it is nongenetic code-based NTinti RNA enzymes that abolish (silence) superfluous/abnormal genetic code-based RNAs. Many examples of the silencing of DNA gene expression were observed in the crisscrossing network of controls in these 80-fold chimerenomic research projects on peanut’s GDH [14].
Superfluous genetic code-based RNAs may now be redefined and expanded to include those transcribed in gross weight quantities outside of the ratios of stoichiometric needs of the cell’s biochemical reactions, mutated genetic code-based RNAs, alternatively spliced genetic code-based RNAs, abnormal/dysfunctional genetic code-based RNAs, and externally introduced genetic code-based RNAs.
4.0 Dissecting Genetic Disorders at the Sub-molecular Levels.
In the series of 80-fold chimerenomic research projects, we added Northern blotting in the tool kit of the science of chimerenomic chemistry to unfold it as a preclinical research discipline – how chimerenomic NTinti RNA enzyme could offer a hope of total cure for many human health disorders caused by dysfunctional genetic code. Genetics and genomics have accomplished a remarkable advancement in therapeutic medicine by structuring primary medical care to depend on the properties of the genetic code. Nongenetic code-based chimerenomic biology is ushering in a new era of rapid advancements in the treatment of human diseases. By exploring the underlying causes at a sub-molecular level, we are gaining unprecedented insights that have the potential to transform medical approaches and enhance therapeutic options.
GDH redox cycle hexameric isoenzymes chigram minus nucleotide sequences and plus nucleotide sequences simultaneously and seamlessly to produce the single-stranded macromolecular NTinti chimerenomic (nongenetic code based-based) RNA enzyme [15], that degrades abnormal and/or superfluous genetic code based-RNA, thus regulating gene expression [1]. Therefore, the presence of plus RNA and minus RNA in the same nongenetic code-based RNA strand instead of in two separate opposite polarity strands of genetic code-based RNA, and application of the cDNA of nongenetic code-based RNA as Northern probes for genetic code-based RNAs is a historical change-making development in genetics because it has allowed chimerenomic chemistry to dive deeper below the molecular level of the gene to its sub-molecular strata (Figures 1-9). The bold Northern bands are cinematographic, and allude to strong base pairing reactions between genetic code-based RNA, nongenetic code-based RNAs, and the two strands of the cDNA probes. The bold Northern bands were evidence that more than two strands of the probe hybridized to the same molecule of genetic code-based RNA, thus making it possible to decipher the sub-molecular chemical mechanism by which the NTinti chimerenomic RNA enzyme selected and degraded the superfluous genetic code-based RNAs, but spared the normal genetic code-based RNAs. The chimerenomic bioinformatics database sequence comparison tool, and the blast 2 nucleotide sequence [10] analysis for the mRNAs versus the chimerenomic RNA probes showed numerous +/+, -/-, -/+, and +/- matches at the sub-molecular level of the mRNAs that could enhance the degradation of the dysfunctional mRNA in an environment of chimerenomic RNA-based therapy. The bold Northern bands (Figures 1-9) showed that genetic code-based RNAs (mRNAs, rRNAs, precursor RNAs, tRNAs, long noncoding RNAs etc) are composite and complex biomolecules in their origin. Therefore, had the traditional genomics-based Northern blot procedure involving the use of genetic code-based probe to match genetic code-based RNAs via quantitative PCR, the projects would have failed to detect the differences between the hybridization of the probe to superfluous RNA and normal genetic code-based RNAs.
4.1 Conversion of magnetoelectric changes of the environmental condition to chimerenomic nongenetic code-based RNA enzyme by hexameric isoenzymes of GDH: Whereas Figures 1 – 9 demonstrate the base pairing hybridization at the sub-molecular level between the mRNAs, the cDNAs of the homologous chimerenomic nongenetic code-based RNA Northern probes, and the chimerenomic nongenetic code-based RNAs chigrammed by the corresponding GDH charge isomers, the conversions of the magnetoelectric changes of the environment by the GDH hexameric isoenzyme populations to arrays of chimerenomic nongenetic code-based RNAs is demonstrated in Figure 10.
The hexameric GDH isoenzyme distribution pattern changed from that of the Control peanut upon treatment of the peanut plants with mineral salts solutions (Figures 10a – 10j). Each GDH distribution pattern was unique to its changed environmental condition and different from that of the other peanuts. The GDH1 and GDH2 nonallelic gene structure [8] with the gene (GDH)1 encoding the more acidic subunits (α, and a) being heterozygous and co-dominant; and the gene (GDH2), encoding the less acidic subunit (b) being homozygous explain the isoenzyme populations in Figure 10. The characteristic 7-10 charge isomers in the Figure suggest the statistical binomial hexameric subunit structure (a, α, and b) to give 28 hexameric isoenzymes in Figure 11 based on the codominant allelic forms of gene GDH1 which controls the synthesis of the two subunits (a, and α), as known for many plants. The experimentally derived populations (Figures 10a – 10j) resemble the binomial statistical distribution (Figure 11) but there were deviations caused by the interplay between nucleophilicity and concentration of the mineral salt ions (electromagnetic nucleophiles). The GDH hexameric isoenzyme distribution patterns induced by the control, NPKS, K, sulfate, PS, and PK deviated the most from the theoretical binomial pattern.
The catalytic mechanism of GDH involves chimmerization of an enzyme-linked Schiff base intermediate between the carbonyl group of α-KG and the ε-amino group of the Lys residue in the active site of the enzyme [16] to form the initiation complex. The Schiff base nitrogen is protonated at neutral pH. The strong electron withdrawing property of the protonated nitrogen so formed predisposes the site to nucleophilic attack. Therefore, the Schiff base readily undergoes alternative nucleophilic reactions depending on the nucleophilicity and concentration of prevalent nucleophiles. Attack by weak nucleophiles (water, ammonium ion etc) release the ε-NH2 group of the Lys residue, breaking the Schiff bond, and liberating the undegraded GDH polypeptide. But the Schiff base could be attacked by strong nucleophiles (K+, SO42-, PO43-, nitrile etc) to form GDH-linked substituted imine complexes that are stable. Ultimately, such modified GDH subunits (dead-end complexes) are degraded because inactivated enzymes are removed by degradation [16]. The deviation from the binomial statistical pattern of the GDH isoenzyme population in the Control, NPKS-treated, KCl-treated, sulfate-treated, PS-treated, PK-treated peanuts (Figure 10) is a consequence of the degradation of the inactivated GDH subunit polypeptides via GDH-linked mineral ion imine complexes. This is the biochemical basis of the differential responses of GDH to nucleophiles [8; 15; 16] including opioids [2].
The demonstration of the conversion of the magnetoelectric changes of the environmental conditions to nucleotide sequence of template-independent chimerenomic (nongenetic code-based) RNA enzyme (Figure 10), and linking their activity directly and visually to the degradation of individual mRNA molecules (superfluous/abnormal genetic code-based RNA) in vivo at the sub-molecular level (Figures 1-9) marks the moment of the conquest of hitherto inexplicable human health disorders through human scientific/technological ingenuity.
Figure 10: Responses of peanut GDH hexameric isoenzyme distribution patterns (a)-(j), and chimerenomic RNA arrays (i)-(x) chigrammed by the charge isomers to mineral treatments of peanut. M is RNA molecular weight marker; t is total RNA.
Control Peanut: Each GDH charge isomers in Figure 10a were made to convert the magnetoelectric change that occurred in the control peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10i. Figure 10a showed that the Control peanut hexameric GDH isoenzymes deviated from that of the binomial statistical pattern (Figure 11), but all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10i) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence. Nongenetic code-based RNA array (Figure 10i) was used for the Control peanut’s Northern blots (Figure 9).
NPKS-treated Peanut: Each GDH charge isomers in Figure 10b were made to convert the magnetoelectric change that occurred in their NPKS-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10ii. Figure 10b showed that the NPKS-peanut hexameric GDH isoenzymes deviated from that of the binomial statistical pattern (Figure 11), but all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10b) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence. Nongenetic code-based RNA array (Figure 10ii) was used for the NPKS-peanut’s Northern blots (Figure 1).
NS-treated Peanut; Each GDH charge isomers in Figure 10c were made to convert the magnetoelectric change that occurred in their NS-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10iii. Figure 10c showed that the NS-treated peanut hexameric GDH isoenzymes resembled that of the binomial statistical pattern (Figure 11). Also, all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10iii) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence. Nongenetic code-based RNA array (Figure 10iii) was used for the NS-treated peanut’s Northern blots (Figure 6).
Inorganic Phosphate-treated peanut: Each GDH charge isomers in Figure 10d were made to convert the magnetoelectric change that occurred in the Pi-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10iv. Figure 10d showed that the Pi-treated peanut hexameric GDH isoenzymes resembled that of the binomial statistical pattern (Figure 11). Also, all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10iv) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence. Nongenetic code-based RNA array (Figure 10iv) was used for the Pi-treated peanut’s Northern blots (Figure 3).
Sodium Sulfate-treated peanut: Each GDH charge isomers in Figure 10f were made to convert the magnetoelectric change that occurred in the sulfate-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10vi. Figure 10f showed that the sulfate-treated peanut hexameric GDH isoenzymes deviated from that of the binomial statistical pattern (Figure 11), but all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10vi) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence. Nongenetic code-based RNA array (Figure 10vi) was used for the sulfate-treated peanut’s Northern blots (Figure 5).
PS-treated peanut: Each GDH charge isomers in Figure 10g were made to convert the magnetoelectric change that occurred in the PS-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10vii. Figure 10g showed that the PS-treated peanut hexameric GDH isoenzymes deviated from the binomial statistical pattern (Figure 11). Also, all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10vii) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence. Nongenetic code-based RNA array (Figure 10iii) was used for the PS-treated peanut’s Northern blots (Figure 8).
Ammonium Chloride-treated peanut: Each GDH charge isomers in Figure 10h were made to convert the magnetoelectric change that occurred in the NH4Cl-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10viii. Figure 10h showed that the NH4Cl-treated peanut hexameric GDH isoenzymes resembled that of the binomial statistical pattern (Figure 11). Also, all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10viii) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence. Nongenetic code-based RNA array (Figure 10viii) was used for the NH4Cl-treated peanut’s Northern blots (Figure 7).
PN-treated peanut: Each GDH charge isomers in Figure 10i were made to convert the magnetoelectric change that occurred in the PN-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10ix. Figure 10i showed that the PN-treated peanut hexameric GDH isoenzymes resembled that of the binomial statistical pattern (Figure 11). Also, all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10ix) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence. Nongenetic code-based RNA array (Figure 10ix) was used for the PN-treated peanut’s Northern blots (Figure 4).
PK-treated peanut: Each GDH charge isomers in Figure 10j were made to convert the magnetoelectric change that occurred in the PK-treated peanuts by chigramming the chimerenomic nongenetic code-based RNAs shown in Figure 10x. Figure 10j showed that the PK-treated peanut hexameric GDH isoenzymes deviated from the binomial statistical pattern (Figure 11). Also, all the charge isomers including those eluted from whole gel chambers 2 – 6 (Figure 10x) were active in the conversion of the magnetoelectric signals to nongenetic code-based RNA sequence. Nongenetic code-based RNA array (Figure 10x) was used for the PK-treated peanut’s Northern blots (Figure 2).
GDH Charged Isomers and the Chimerenomic RNA Arays they Chigrammed:
Each GDH charged isomer is represented by subunits arranged vertically in the micrograph shown in Figure 10 (a–j), which corresponds to the vertical layout of chimerenomic nongenetic code-based RNA arrays chigrammed in Figure 10 (i–x). Each of these vertical chimerenomic RNA arrays signifies a comprehensive chimerenomic RNA family, termed chimerenomic ATinti RNA. When chimerenomic RNA is chigrammed using one or more vertical lanes of GDH charged isomers (as indicated in Figure 10, lanes 1–13), it produces a larger composite family of RNA known as chimerenomic NTinti RNA. This process underscores the intricate relationships between the charged isomers and the formation of complex chimerenomic RNA structures.
Figure 11: Binomial statistical distribution of GDH subunit polypeptides based on the a and α subunits being more acidic than the b subunit. The vertical columns are the subunit compositions of the GDH charge isomers used for the chigramming experiments of the electrochemical gradients of chimerenomic RNAs (Figures 1-9).
Rotofor IEF chamber pH values
<6.0 6.8 7.5 7.7 8.2 8.5 8.8
αααααα αααααB ααααBB αααBBB ααBBBB αBBBBB BBBBBB
AAAAAA AAAAAB AAAABB AAABBB AABBBB ABBBBB
αααααA ααααAB αAAABB αAABBB αABBBB
ααααAA αααAAB ααAABB ααABBB
αααAAA ααAAAB αααABB
ααAAAA αAAAAB
αAAAAA
5.0 General Discussion
5.1 Core Principles of Chimerenomic Chemistry as Demonstrated in these Experimental Studies
5.1.1 GDH Charged Isomers and Nongenetic Code-based RNA Chigramming
The experiments elucidate the role of GDH (Glutamate Dehydrogenase) charged isomers in the chigramming of their corresponding nongenetic code-based RNAs. This biochemical process is depicted in Figure 10, where micrographs are juxtaposed for enhanced clarity. The isoenzyme profiles generated from GDH fingerprints exhibit a consistent correlation with nongenetic code-based RNA arrays across a series of 80 chimerenomic research projects. This consistency underpins the foundation of chimerenomic chemistry in preclinical investigations, as delineated in the work by Osuji et al. [6].
5.1.2 Environmental Response Mechanisms
The NADH-GDH hexameric enzyme demonstrates the capacity to detect environmental alterations—such as fluctuations in nucleophiles, including opioid nucleophiles. In response to these shifts, it catalyzes the formation of novel charged isomers, which are subsequently chigrammed into new nongenetic code-based RNAs that act as environmental signatures (refer to Figure 10). These nongenetic code-based RNAs function to reprogram cellular metabolism, facilitating cell adaptation and survival in diverse environmental contexts. Specifically, they target various forms of genetic code-based RNAs—such as mRNA, siRNA, rRNA, etc.—allowing for precise modulation of metabolic pathways.
5.1.3 Experimental Evidence from Northern Blot Analyses
Figures 1 through 9 illustrate the results of Northern blot analyses, confirming that nongenetic code-based RNAs, chigrammed by GDH and homologous to specific mRNAs related to peanut development, selectively bind to 32P-labeled nongenetic code-based RNAs. The findings indicate that these nongenetic RNAs are capable of selectively degrading superfluous or aberrant mRNAs while preserving essential mRNAs, thereby optimizing metabolic efficiency. The initial phase of this selective degradation involves the elimination of mRNAs from previous environment, thereby facilitating the de novo transcription of new genetic code-based RNAs crucial for gene expression.
5.1.4 Comparative Analysis of Environmental Effects
An analysis of Northern blot radiographs reveals distinct differences between Figure 9—representing a typical growth environment devoid of supplemental mineral nutrients—and Figures 1–8, which incorporated specified mineral enhancements. The radiograph from Figure 9, serving as a control, exhibited minimal mRNA expression for specific enzymes, except for Nitrate Reductase, which was selectively expressed due to the influence of nitrogen-fixing bacteria present in the compost soil. This observation indicates that nongenetic code-based RNAs initiate a degradative response towards legacy (past environment) mRNAs, reprogramming metabolism in response to new environmental conditions.
5.1.5 Interactions Among Nongenetic Code-Based RNAs
Significantly, the experiments demonstrated that nongenetic code-based RNAs do not exhibit degrading activity towards homologous nongenetic code-based RNAs. They may, however, engage in binding interactions, as evidenced by the hybridization of 32P-labeled GDH chigrammed nongenetic code-based RNAs to their homologous counterparts in the Northern blot analyses. This finding substantiates the hypothesis that nongenetic code-based RNAs are non-immunogenic and exhibit no toxicity when introduced within the same species, marking a critical insight into their potential therapeutic applications.
The comprehensive series of projects—encompassing mineral nutrient treatments in peanuts, investigations involving NADH-GDH charged isomers, and the chigramming of corresponding nongenetic code-based RNAs—has culminated in extensive experimental studies. This includes 32P-labeled nongenetic code-based RNA studies, hybridization experiments, and quantitative analyses via UN-SCAN-IT radiographic techniques. These methodologies have been replicated across 80 distinct projects, resulting in a cumulative total of over 400 projects. The vast experimental dataset generated from these projects provides a robust foundation for chimerenomic RNA sciences, consistently yielding reproducible and reliable results. This extensive body of work solidified the principles underlying chimerenomic RNA technologies and lays the groundwork for our understanding and applications of this novel science.
5.1.6 GDH Charged Isomers and the Chimerenomic RNA Arays they Chigrammed:
Each GDH charged isomer is represented by subunits arranged vertically in the micrograph shown in Figure 10 (a–j), which corresponds to the vertical layout of chimerenomic nongenetic code-based RNA arrays chigrammed in Figure 10 (i–x). Each of these vertical chimerenomic RNA arrays signifies a comprehensive chimerenomic RNA family, termed chimerenomic ATinti RNA. When chimerenomic RNA is chigrammed using one or more vertical lanes of GDH charged isomers (as indicated in Figure 10, lanes 1–13), it produces a larger composite family of RNA known as chimerenomic NTinti RNA. This process underscores the intricate relationships between the charged isomers and the formation of complex chimerenomic RNA structures.
5.1.7 Metabolic Modulation via GDH Charged Isomers
Each GDH charged isomer, specific to a given environmental condition (as illustrated in Figure 10), facilitates targeted chigramming of nongenetic code-based RNA arrays. This targeted mechanism affirms the capacity for metabolic modulation across multiple genes. Notably, research conducted by AAPCR illustrates the modulation of metabolic pathways through innovative astrocyte studies. For instance, exposure to nucleophiles such as morphine initiates significant environmental changes, resulting in the production of engineered GDH isomers. These isomers have been optimized to facilitate the generation of complex NTinti RNAs, with millions of chimeres (Table 1) that may be homologous to thousands of mRNAs associated with various disease pathologies. Furthermore, NTinti RNAs specific to morphine and genes related to opioid overdose, neurotransmitters, and receptors are chigrammed, laying the groundwork for subsequent drug formulation efforts.
This comprehensive overview underscores the intricate principles of chimerenomic chemistry as elucidated in the experimental findings, highlighting their promising implications for therapeutic innovations in the biomedical field.
5.2 Medical and Clinical Applications of Chimerenomic Nongenetic Code-based RNA Technologies
5.2.1 Introduction to Chimerenomic RNA and Metabolic Reprogramming
Emerging insights into how internal and external environmental signals influence cellular metabolism herald a transformative era in biotechnology, medical research, and clinical applications. The capacity of cells to convert environmental stimuli into nongenetic code-based RNA—and subsequently utilize that RNA to reprogram metabolic processes—is a groundbreaking finding with profound implications for medicine. These nongenetic code-based RNAs possess the potential to target specific metabolic pathways, effectively reprogramming and correcting metabolic dysregulation. This advancement sets the stage for novel therapeutic strategies and drug development in the coming century.
5.2.2 Targeted Therapeutic Potential of Nongenetic Code-Based RNAs
Each nongenetic code-based RNA functions as a candidate drug, uniquely equipped to target individual metabolic pathways or specific mRNAs (genes), or to modulate multiple genes concurrently. As a result, these nongenetic code-based RNAs hold promise for treating diseases that have previously defied conventional therapeutic approaches. Failures of existing treatment methodologies often stem from an oversimplified understanding of disease etiologies, particularly the reductionist notion of "one gene, one disease."
This paradigm is increasingly recognized as inadequate; many diseases arise from multifactorial interactions among genes. The complexities of conditions such as opioid addiction illustrate this point—no single gene can account for the spectrum of addiction disorders, presenting a significant challenge to proponents of the "one gene, one disease" hypothesis. Therefore, the concepts of "many genes, one disease" or "one gene, many diseases" better capture the intricacies of human pathology, reinforcing the need for a holistic understanding of disease mechanisms.
5.2.3 Chimerenomic Science: Nature’s Evolutionary Insights
Chimerenomic science embraces the evolutionary wisdom embedded within biological systems, revealing how life has adapted to survive and thrive in diverse and often harsh environments. These adaptations include inherent mechanisms for repair and healing, which are integral to the concept of environmental signaling. The role of chimerenomic RNAs in mediating metabolic reprogramming in response to internal and external cues is well exemplified through the series of experiments detailed in this publication (see Figure 10).
5.2.4 Future Directions in Therapeutic Development
The implications of chimerenomic nongenetic code-based RNA technologies are vast. Future research should aim to elucidate specific pathways and mechanisms through which these RNAs exert therapeutic effects, as well as their potential interactions with existing treatment modalities. Additionally, rigorous clinical trials are essential to evaluate the efficacy and safety of these innovative therapies in diverse patient populations.
In summary, the intersection of chimerenomic science and medicine stands poised to reshape our understanding of disease, paving the way for targeted, personalized treatment strategies that address the complexities of human health and pathology. The promise of nongenetic code-based RNA technologies represents not just a leap in therapeutic capabilities but a redefinition of how we approach the treatment of diseases in the next century.
5.3 Characteristics of an Ideal Gene Targeting Technology: Chimerenomic RNA Technology Blueprint
Targeted Gene Regulation Using Chimerenomic RNA
Chimerenomic RNA technology exemplifies an ideal gene targeting mechanism, particularly demonstrated through its precision in targeting mRNAs for proteins and enzymes such as phosphate translocator, phosphoglucomutase, glucosyltransferase, granule-bound starch synthase, GARS/GART, nitrate reductase, acetyl-CoA carboxylase, and NADH-GOGAT. The use of 32P-labeled cDNA derived from nongenetic code-based RNA chigrammed from GDH charged isomers allowed for precise targeting and subsequent documentation via radiographic imaging (Figures 1–9). These radiographs illustrate the specific binding of cDNA to corresponding mRNAs, confirming the ability of chimerenomic RNAs to induce gene degradation and silencing with extreme specificity.
5.3.1 Specificity and Efficacy of Chimerenomic RNA
The experimental results substantiate that chimerenomic RNA possesses unique chemical properties enabling selective binding, degradation, and silencing of superfluous mRNAs—those arising from distorted gene expressions—while preserving normal mRNAs. Control experiments (Figure 9) clearly demonstrate the complete silencing of targeted mRNAs, reinforcing the specificity and efficacy of chimerenomic RNA as a tool for gene regulation.
Chimerenomic RNAs employ several mechanisms to identify superfluous RNAs, including the sensing of specific RNA segments, stoichiometric ratios, and environmental-dependent temporal expressions. These insights into the underlying molecular interactions offer a comprehensive understanding of how chimerenomic RNAs achieve selective targeting at a molecular level.
5.3.2 Advantages Over Genetic Editing Technologies
Chimerenomic RNA stands out as an ideal gene silencing vehicle due to its non-invasive nature; it can silence or degrade specific genes without the accompanying risks associated with genetic and genomic editing technologies. Unlike traditional gene editing techniques that alter DNA sequences, chimerenomic RNA operates independently of the cell's genomic integrity, mitigating potential adverse effects (see Table 3). This attribute positions chimerenomic RNA as a safer alternative, effectively silencing multiple genes concurrently, particularly when large innovative NTinti RNAs are employed, which can target thousands of genes for regulatory purposes.
5.3.3 The Mechanism of Gene Regulation
The inherent capability of chimerenomic RNA to selectively degrade and silence aberrant mRNAs while sparing normal genetic transcripts underscores its extraordinary potential in gene regulation. This selective targeting facilitates the preservation of genetic integrity, allowing for the regulation of gene expression without modifying the underlying DNA sequences. This approach embodies a novel blueprint for gene regulation and preservation, emphasizing the ability to manage gene expression in a controlled and safe manner.
In summary, chimerenomic RNA technology represents a paradigm shift in gene targeting methodologies. Its specificity, capacity for temporary or permanent gene silencing, and avoidance of detrimental impacts on DNA make it an exemplary candidate for advancing gene regulatory sciences and therapeutics. As research progresses, the full potential of chimerenomic RNA technologies is likely to revolutionize the fields of genetics, molecular biology, and medicine, providing innovative solutions for previously inexplicable diseases.
5.4 From Probes to Drugs: Nongenetic Code-based RNA Therapeutics
Overview of Nongenetic Code-based RNA Probes Used in these Studies
Our research has demonstrated the efficacy of nongenetic code-based RNA as probes in vitro, effectively interrogating metabolic processes that occur in vivo, as illustrated in Figures 1 through 9. These probes serve not only as diagnostic tools but also possess therapeutic potential when produced and deployed in vivo.
5.4.1 Transforming Probes into Therapeutics
Nongenetic code-based RNA can be synthesized analogously to the probes used in experimental settings, allowing their application in clinical contexts to monitor and modulate metabolic processes associated with various disease states. These nongenetic code-based RNA drugs are designed to target specific mRNAs implicated in human diseases, thereby enabling interventions that facilitate gene silencing and metabolic reprogramming.
5.4.2 Mechanism of Action
The primary mechanisms through which nongenetic code-based RNA drugs exert their therapeutic effects include:
5.4.3 Clinical Implications
The application of nongenetic code-based RNA drugs holds tremendous promise for treating a wide range of human diseases. By precisely targeting and modulating specific genetic expressions, these therapeutics provides novel treatment options for conditions that have thus far proven refractory to traditional therapies.
In summary, the transition from nongenetic code-based RNA probes to therapeutics exemplifies a significant advancement in molecular medicine. These RNA drugs not only allow for the interrogation of metabolic pathways but also offer a viable strategy for achieving therapeutic outcomes through gene silencing and metabolic reprogramming. Continued research and clinical trials are necessary to fully elucidate their potential benefits and expand their applications in the treatment of human ailments.
5.5 Targeting Multiple Specific Genes with Chimerenomic NTinti RNA: Novel Therapeutics for Drug Addiction
5.5.1 Overview of NTinti RNA in Addiction Research
In a recent investigation involving human astrocyte cells, we exposed these cells to varying molar concentrations of morphine to simulate environmental changes associated with addiction. As a result, large NTinti RNAs were generated and employed to target 17 specific mRNAs associated with addiction mechanisms [2]. Notably, all targeted mRNAs exhibited homology to the NTinti RNA produced from astrocytes in the presence of morphine.
5.5.2 Properties of NTinti RNA Ideal for Drug Formulation
NTinti RNAs, while large molecules, display a liquid hydrophilic nature that permits solubility in just 1 µL of solution. This characteristic facilitates their formulation into deliverable drug forms, enhancing their practical applicability in clinical settings [3].
5.5.2.1 Mechanism of Action
The NTinti RNA drug demonstrates the following therapeutic actions:
5.5.3 Experimental Evidence
The experiments detailed in this publication (Figures 1–9) illustrate the shared mechanisms by which NTinti RNA targets, degrades, and silences abnormal mRNAs associated with addiction while preserving the integrity of normal mRNAs. This selectivity is crucial for maintaining healthy cellular function amidst therapeutic intervention.
5.5.4 Safety Profile
NTinti RNAs are designed to be tissue-specific and non-immunogenic, minimizing the risk of adverse reactions. Furthermore, they are anticipated to be free of metabolic side effects, making them a promising therapeutic option in the management of drug addiction.
In summary, chimerenomic NTinti RNA represents an innovative approach to treating drug addiction by targeting multiple specific genes involved in the addiction pathway. The ability to reprogram cellular metabolism and restore normal astrocyte function underscores the potential of NTinti RNA as a novel therapeutic strategy for many human diseases. Continued research and clinical trials will be essential to expand on these findings and explore the full therapeutic capabilities of NTinti RNA in the treatment of addiction and many human diseases.
Table 2: Nucleotide Sequences of the Northern Probes
Granule-bound Starch Synthase (GBSS) gb|ACL98483.1|: starch synthase IIa
CAAUGCUAAGCGGGAAUACUCAGGACUGGCUCUUGGCGCGCAACUACCCUACUCAGGCCUGGCGGUUGCCGUACUAUUGCUACUCAGACCUGCCUCGAAUGAGAAAUAUUACUACUCAGGACUGGCUGUUGCCCAAACUAUCGAAACUAAGGACUGGCUGACGCCGUAACUAUCGCUACUCAGACACCUACCCUAUACGUCUGAUGGUCUUGGACUAACCGCUGA
NADH-GOGAT gb|L01660.1
GGGUAUAANCNNNUUGCAGGCGCGCUUAGGGGAAUGACCUGAGCUCUGACCAUGGGCUACGUCUCCGCCCUUUUGUACUUUACUCGAGUUCGUCCGGCACUUCCAACGGCUCGAAAACUUCACGUUGGGCUACCUCCUUUAGACGCCCCACUACAAAGUGGUCCUGCAUUACCUCGCCCUAAAGACCUGCCUGUAAAAGGUCGUCUGUCAGUGGCUUUUGCUGGCGGCGGUGAUGAAGUUCUUCCAAAUCCGUCCGAUAGCCAGUCCUGAGUAUU
Phosphate translocator2-1dbj|BAD16885.1
GUCCNANCGNCAAGCCGGCAAUUCCNACCAGNNANAAAUUCAAGGAACACNUUUCGGGACCCGAGNNNANNNACCCUUGANCGUCACCUAUGACCCGCUGAUCUCACACCAUCUCCCAUCGCCUUAAGGACCACAUCGUCACUUUACGCAUCUCUAGUCCUCCUUGUAGGUACCGCUUCCGUCGAUGGACCUGGUUGUGACUGUGACUCCGUGCUUUCGCACCCCUCGUUUGUCCUAAUCUAUGGGACCAUCAGGUGCGGGAUUUGCUACGCUUGACCUACAACCCACGUUAAACCGUGCGUCAUAGCUUCGAUUGCGCAAUUCAAGCGGCGGACCCCUCAUGCCAGCGUUCUGACUUUGNGUUUCCUUAACUGCCCNUUN
Acetyl-CoA carboxylase (ACCase) gb|L39267.1|
UGACGUCGAUGCUAAGCGGGAAUACUCAGGACUGGCUCUUGCCGUAACUAUCGCUACUCAGGACUGGCUGUUGCCGUAACUAUCGCUACUCAGGACUGGCUGUUGCCGUAACUAUCGCCUACUCAGGACUGGCUGUUGCCGUAACUAUCGAUACUCAGGACUGGCUGUUGCCGUAACUAUCGCUACUCAGGACUGGCCCAUGCGUCAGAUGCUCUGGUCAUUC
Glucosyltransferase mRNA. GenBank accession: GQ373182.1
AGTTCCCCAGCAACGTATTTGCCAAAGCAAATGTCGCTAAAATAGACAACGCCACCAAAGCATCAGTTGAATCCCGAACAAAATAAACAAACATGAAAGGCTTGCAACACGCAACGCCACCTCCAAAAAGACGACAAGCGCAATCTTCTCGGTCGGACTCATAAGGG
Nitrate reductase 1. ACCESSION NP_177899
AAANCCTTACTGGATCTCGTAAGACTGCGTACCCGATGCAAAAGGCGGGAAAACATGAAATAGCGTCAAGCAGGCCGTGAATTGCCGAGCTTTTGAAGTGCAACCCGATGGAGGTTATCTGCGGGTATGTTTCACCAGGAGTAtTGAGCGGGATTTCTGGACGGAACCAGCAGACAGTCACCGAAAACGACCCCGCCACTACTTCAAGAAGGTTTAGGCAGGCTATCGGTCAGGACTCATAAGGGCG
Formylglycinamide ribonucleotide amidotransferase (GARS/GART). Accession number AY069939.1.
GNANNGGCGCGAATNGCCGCTTANGAGGTCCTGACCGAATNCNGCAGCAANGCACCCGTATGGCGGATGCTTCCTCACCGGTCACNCCTGNATCGGGGTANNCAGCTNCTACNAGGACNAGATACGCACATCCTACGAGACCAGTTACGCAGTCTACNANACNTNTATNAGTCCTGACCGAATCANANACGTGGGTGAANGACACCATTAACATGTCCGGNAAACCGTTNGGGNACCCANTCNACNAGACAGT
Phosphoglucomutase. Accession number AJ250770.1
GNCGGCGCGNATNGCACCNGACGAGNNCGGTACACGAAATCANANAGCTNNAANNAGNAGCANATANNANACATNGANGGGNNCAAATNANGCNTCNCTANNANNGCTGTATGAAGNATNNCCACCNGTTACNTTNNGNNCGTCTGATCNAGNTNCGATGTAGNAGCNNTATGTATTNCCNAACTCAGTGTNGAGTATCCTTCNGTTAATGATGCGGTNAGTGAAGTACTTGGGAAGCNTCCCATCCGCGNTTANCAAANGNGGTGCTTTGGTTTCCCNGGTTTCGTACNTGAANGGTGACTTGTACGCTTGGACCGGATCCANANACANNTACAGGTGCGGGTTGTCCGCTACGATCAAGAAAGTCGGGTACGCAGTCTACGAGACCAAGGGCG
Table 3: Comparison of Genetic Gene Editing Technology with Chimerenomic Gene Silencing Technology.
|
Differences
|
Gene Editing Technology |
Chimerenomic Gene Silencing Technology
|
|
Site of action
|
Genetic Code DNA |
Genetic Code RNA |
|
Type of action
|
DNA editing |
RNA silencing |
|
Result of action
|
Permanent change in DNA |
No tampering with DNA |
|
Limitation
|
Very limited, cannot edit multiple genes at the same time |
Unlimited, can silence multiple genes at the same time
|
|
Off-Target Effects |
This occurs when the "search query" accidentally matches a different part of the DNA text. The system makes unintended cuts in healthy genes, which could potentially cause new medical problems or lead to cancer.
|
No Off-Target Effects |
|
On-Target Effects |
If and when the system finds the exact right spot, the cell's automatic "repair crew" can sometimes make mistakes. When patching the cut, it might accidentally delete a large section of surrounding DNA or scramble the text.
|
No On-Target Effects |
|
Immune Reactions |
The Case protein (the molecular scissors) is originally derived from bacteria. Because of this, a patient's immune system recognizes it as a foreign invader and attack it, causing severe inflammation or rendering the treatment useless.
|
Non-immunogenic within species |
|
Mosaicism |
In some treatments, the editing doesn't successfully take place in every targeted cell. This creates a "mosaic" mix of edited and unedited cells, which might make the treatment only partially effective.
|
No Mosaicism |
|
Gene Identification |
Cumbersome |
Easy, using homology searches
|
References
1.Osuji GO, Okea RN (2024). Environment-wide reprogramming of total RNA abundance and metabolic processes by glutamate dehydrogenase-synthesized RNA enzyme: Terminologies for the new RNAs. JAAPCR vol. 1: Issue 1.
2. Okea RN, Osuji GO (2026). Human Astrocyte NADH-Glutamate dehydrogenase- produced macromolecular nongenetic code-based RNA enzymes for treating and curing drug addiction. JAAPCR vol. 3, issue 5.
3. Okea RN, Osuji GO (2026). Primary, secondary, and tertiary structures: Properties of macromolecular nongenetic code-based RNA enzyme synthesized by redox cycle NADH-glutamate dehydrogenase. JAAPCR vol. 3, issue 6.
|
4. Osuji GO, Brown TK, South SM, Duncan JC, Johnson D (2011). Doubling of crop yield through permutation of metabolic pathways. Advances in Biosciences and Biotechnology, Vol. 2, No. 5, pp. 364-379. doi:10.4236/abb.2011.25054 |
|
5. Osuji GO, Brown TK, South SM (2010). Optimized fat and cellulosic biomass accumulation in peanut through biotechnology. International Journal Biotechnology & Biochemistry, Vol. 6, pp. 455-476. |
6. Osuji GO, Konan J, M’Mbijjewe G (2004). RNA synthetic activity of glutamate dehydrogenase. Applied Biochem Biotech. 119: 209-228.
7. Osuji GO, Madu WC, Braithwaite C, Beyene A, Roberts PS, Bulgin A, Wright V (2003/4). Nucleotide-dependent isomerization of glutamate dehydrogenase in relation to total RNA contents of peanut. Biol. Plant. 47: 195-202.
8. Osuji GO, Madu WC (1995). Ammonium ion-dependent isomerization of glutamate dehydrogenase in relation to glutamate synthesis in maize. Phytochemistry 39: 495-503.
9. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990). Basic local alignment search tool. J. Mol. Biol. 215: 403-410.
10. Tatusova T, Madden TL (1999). Blast 2 sequences – A new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 174: 247-250.
11. Grierson D, Slater A, Speirs J, Tucker GA (1985). The appearance of polygalacturonase mRNA in tomatoes. Planta 163: 263-271.
12. Osuji GO, Brown T, South S, Duncan J, Johnson D, Hyllam S (2012). Molecular adaptation of peanut metabolic pathways to wide variations of mineral ion composition and concentration. American Journal of Plant Sciences, 3, 33-50. doi: 10.4236/ajps.2012.31003.
13. Osuji GO, Madu WC, Johnson PM (2019). Total RNA degradation in vitro and in vivo by glutamate dehydrogenase-synthesized RNA enzyme: Biotechnological applications. Advances Bioscience and Biotechnology 10, 59-85.
14. Osuji GO, Madu WC (2015). Glutamate dehydrogenase. In Amino Acids in Higher Plants. D’Mello JPF Eds. Chapter 1 pages 1 – 29. CAB International Publisher, Boston, USA.
15. Osuji GO, Okea RN (2024). The Chimerenomic Pump: Large-Scale Production of Glutamate Dehydrogenase-Synthesized RNAs. JAAPCR vol. 1: Issue 2.
16. Osuji GO, Braithwaite C, Pointer R, Reyes J (1999). Pesticide inactivation of peanut glutamate dehydrogenase: Biochemical basis of the enzyme’s isomerization. J. Agric Food Chem. 47(8): 3345-5551.
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle
JournalsArticle